C57BL/6J-Nlrc4^em3Vnce/J

Stock number: 036637
Product name: Nlrc4^S533D, Nlrc4^{em2(S533D)Vnce}
Research areas: Cell Biology Research

Description

Nlrc4^S533D mice carry a CRISPR/Cas9-generated serine to aspartic acid mutation in amino acid 533 of the mouse Nlrc4 (NLR family, CARD domain containing 4) gene. The mutation is phosphomimetic (mimicking a phosphorylated state), but protein is expressed normally. These mice are useful for investigating the role of NLRC4 phosphorylation.

Detailed description

Nlrc4^S533D mice carry a CRISPR/Cas9-generated serine to alanine mutation in amino acid 533 of the mouse Nlrc4 (NLR family, CARD domain containing 4) gene. The mutation is phosphomimetic (mimicking a phosphorylated state), and protein is expressed normally. Western blot experiments confirmed the expression of peptides from this allele. The mutation has minimal known effects on NLRC4 function.

Macrophages from homozygous mice display lactate dehydrogenase (LDH) release kinetics comparable to wildtype controls and do not show evidence of spontaneous inflammasome activation in the absence of FlaTox (a reagent to deliver Legionella pneumophila flagellin into the cytosol of cells).

Development

Nucleotide changes were introduced to codons R530, Q531, S533 and E532 using CRISPR/Cas9 methodologies. The serine at position 533 was modified to aspartic acid (S533D; TCA to GAT) using sgRNA 5'-CTCTGGAGGCAGGAATCAAT-3', creating a coding change in exon 4. Synonymous changes were introduced at R530 (AGG to AGA), Q531 (CAG to CAA), and E532 (from GAA to GAG). The mutations were created in C57BL/6J embryos and the line was backcrossed to C57BL/6J for at least 3 generations by the donating laboratory.

Allele

Symbol: Nlrc4^em3Vnce
Name: endonuclease-mediated mutation 3, Russell E Vance
MGI accession ID: MGI:6508703
Generation method: Endonuclease-mediated
Attributes: Not Applicable
Synonyms: Nlrc4^{em3(S533D)Vnce}; Nlrc4^S533D
Marker symbol: Nlrc4
Marker name: NLR family, CARD domain containing 4
Marker synonyms: 9530011P19Rik; AIFEC; Card12; CLAN; CLAN1; CLANA; CLANB; CLANC; CLAND; CLR2.1; FCAS4; IPAF
Chromosome: 17
Strain of origin: C57BL/6J
Molecular note: Serine codon 533 (TCA) was targeted with an sgRNA (targeting CTCTGGAGGCAGGAATCAAT) and ssODN templates using CRISPR/Cas9 technology, changing it to aspartic acid codon GAT (p.S533D). This mutation creates a phosphomimetic residue at this position. Western blot experiments confirmed the expression of peptides from this allele.