B6;SJL-Mchr1^em1Mctr/J

Stock number: 036509
Product name: Mchr1^ch
Research areas: Neurobiology Research, Research Tools

Description

Mchr1^ch knock-in mice contain a CRISPR/cas9 generated insertion of an HA-tagged mCherry inserted adjacent to and in-frame with the Mchr1 start codon. These mice may be useful when studying MCHR1 function and signaling in the brain.

Detailed description

Mchr1^ch knock-in mice carry a CRISPR/cas9 generated insertion of an HA-tagged mCherry inserted adjacent to and in-frame with the start codon of the melanin-concentrating hormone receptor 1 Mchr1. Mchr1 encodes a G protein-coupled receptor that acts as a neuropeptide and is expressed in the central and peripheral nervous systems where it plays an important role in the control of feeding behaviors and energy metabolism. Homozygous mice are viable and fertile.

The HA-signal correctly localizes to the cilia. Mice are useful for surface labeling and monitoring internalization of ciliary GPCRs following stimulation as well as specific ciliary vs non-ciliary protein-protein interactions. The donating investigator reports no differences in localization across development in neurons of the hypothalamus, however mice have a reduction of synaptic strength.

mCherry fluorescence is detected by immunohistochemistry but not by direct fluorescence.

Development

The donor plasmid was designed to insert an HA-tagged mCherry adjacent to and in-frame with the start codon of the melanin-concentrating hormone receptor 1 (Mchr1) gene. A signal guide RNA plasmid (gctgcatggatctgcaagcc) and the cas9 nuclease were introduced into the cytoplasm of (C57BL/6 X SJL)F1-derived fertilized eggs with well recognized pronuclei. Targeted embryos were transferred to pseudopregnant females. Correctly targeted pups were identified by sequencing and PCR and resulting Mchr1^ch mice were C57BL/6J mice (Stock No. 000664) for at least 3 generations. Off-target sites were not screened for. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

Allele

Symbol: Mchr1^em1Mctr
Name: endonuclease-mediated mutation 1, Jeremy McIntyre
MGI accession ID: MGI:6729884
Generation method: Endonuclease-mediated
Attributes: Reporter; Epitope tag
Synonyms: Mchr1^ch
Marker symbol: Mchr1
Marker name: melanin-concentrating hormone receptor 1
Marker synonyms: Gpr24; Gpr24-9; Mch1r; Mch-1r; Slc1; SLC-1
Chromosome: 15
Strain of origin: (C57BL/6 x SJL)F1
Molecular note: CRISPR/cas9 genome editing is used to insert an HA-tagged mCherry adjacent to and in-frame with the start codon.