B6;SJL-Gt(ROSA)26Sor^em1(TAg)Sac/J

Stock number: 036418
Product name: Rosa26^LSL-SV40-GFP
Research areas: Cancer Research, Research Tools

Description

Rosa26^LSL-SV40-GFP mice have a CRISPR/cas9 generated insertion of a floxed STOP cassette and an SV40 T antigen coding region followed by an IRES-EGFP cassette inserted into the endogenous Gt(ROSA)26Sor locus. When crossed with a Cre recombinase expressing strain, removal of the floxed STOP cassette will result in SV40 and EGFP expression in cre expressing tissues. These mice may be useful for the generation of immortalized cell lines and fluorescent tracking of tumorigenesis.

Detailed description

Rosa26^LSL-SV40-GFP mice have a CRISPR/cas9 generated insertion of a floxed STOP cassette and an SV40 T antigen coding region followed by an IRES-EGFP cassette inserted into the endogenous Gt(ROSA)26Sor locus. When crossed with a cre recombinase expressing strain, removal of the floxed STOP cassette will result in SV40 T antigen and EGFP expression in cre expressing tissues. Homozygous Rosa26^{LSL-SV40-GFP/LSL-SV40-GFP} mice are viable and fertile.

When bred with Prop1-cre mice or Tshb-cre mice that express cre in the pituitary gland, the resulting offspring from both lines develop fully penetrate dwarfism and large tumors by 4 weeks. Tumors from both of these mouse lines are capable of being adapted to cell culture growth.

EGFP fluorescence is detected by immunohistochemistry or FACS analysis.

Development

The donor plasmid is designed to insert a floxed STOP cassette (including a neomycin resistance cassette), an SV40 T antigen coding region, an internal ribosome entry site (IRES), and an enhanced green fluorescent protein (EGFP) sequence into the endogenous Gt(ROSA)26Sor locus. A signal guide RNA, sgROSA26-1 (TCTGCAACTCCAGTCTTTCTAGAAGATGGGCGGGACTCTTCT), circular DNA donor plasmid, and the cas9 nuclease were introduced into the cytoplasm of (C57BL/6 X SJL)F1-derived fertilized eggs with well recognized pronuclei. Targeted embryos were transferred to pseudopregnant females. Correctly targeted pups were identified by sequencing and PCR and resulting Rosa26^LSL-SV40-GFP mice were maintained on a mixed B6;SJL genetic background. No off-target sites are present. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J (Stock No. 000664) oocytes.

In 2021, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the males sent to The Jackson Laboratory Repository. One of the 43 markers on Chromosome 7 was segregating with an unknown source.

Allele

Symbol: Gt(ROSA)26Sor^em1(TAg)Sac
Name: endonuclease-mediated mutation 1, Sally Camper
MGI accession ID: MGI:6711970
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed); Reporter; Inserted expressed sequence
Synonyms: Rosa26^LSL-SV40-GFP
Marker symbol: Gt(ROSA)26Sor
Marker name: gene trap ROSA 26, Philippe Soriano
Marker synonyms: beta geo; Gtrgeo26; Gtrosa26; R26; ROSA26; SETD5-AS1; Thumpd3as1
Chromosome: 6
Strain of origin: (C57BL/6 x SJL)F1
Molecular note: CRISPR/cas9 genome editing is used to insert a floxed STOP cassette (including a neomycin resistance cassette), an SV40 T antigen coding region, an internal ribosome entry site (IRES), and an enhanced green fluorescent protein (EGFP) sequence into the endogenous Gt(ROSA)26Sor locus.