C57BL/6J-Ms4a3^em2(cre)Fgnx/J

Stock number: 036382
Product name: Ms4a3^cre
Research areas: Immunology, Inflammation and Autoimmunity Research, Research Tools

Description

Ms4a3^Cre knock-in mice express Cre recombinase under direction of the Ms4a3 promoter in granulocyte-monocyte progenitor cells (GMPs).

Detailed description

Ms4a3^Cre knock-in mice express Cre recombinase under direction of the membrane-spanning 4-domains, subfamily A, member 3 (Ms4a3) promoter. Ms4a3 encodes a protein specifically expressed by granulocyte-monocyte progenitors (GMPs) and common monocyte progenitors (cMoPs) but not monocyte-dendritic cell progenitor (MDP) and their dendritic cell (DC) progeny. Homozygotes are viable and fertile. When bred with mice containing loxP-flanked sequences, Cre-mediated recombination will result in deletion of the floxed sequences in the Cre-expressing cells of the offspring.

When bred to ROSA26^tdTomato (Ai14) mice (Stock No. 007914), resulting Ms4a3^Cre-Rosa^TdT mice are a fate-mapper model used specifically to dissect monocyte-differentiation pathways as well as follow monocytes and their progenies, such as neutrophils and others GMP-derived cells.

Development

Plasmids encoding a signal guide RNA (TTCTGCTGAGTTTTCAAATGAGG), designed to insert an internal ribosome entry site (IRES) fused to a Cre recombinase sequence into the 3' UTR of the membrane-spanning 4-domains, subfamily A, member 3 (Ms4a3) gene, and the cas9 nuclease were introduced into the cytoplasm of C57BL/6J-derived fertilized eggs with well recognized pronuclei. Targeted embryos were transferred to pseudopregnant females. Correctly targeted pups were identified by sequencing and PCR and further backcrossed to C57BL/6J mice for three generations to eliminate off-target effects in the resulting colony of Ms4a3^Cre mice. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. 000664).

Allele

Symbol: Ms4a3^em2(cre)Fgnx
Name: endonuclease-mediated mutation 2, Florent Ginhoux
MGI accession ID: MGI:6726593
Generation method: Endonuclease-mediated
Attributes: Recombinase-expressing
Synonyms: Ms4a3^Cre; Ms4a3^em2(cre)Smoc
Marker symbol: Ms4a3
Marker name: membrane-spanning 4-domains, subfamily A, member 3
Marker synonyms: CD20L; haematopoietic cell-specific transmembrane-4; HTm4
Chromosome: 19
Strain of origin: C57BL/6J
Molecular note: An Ires-cre expression cassette was inserted into the 3' un-translated region (3'UTR) of the Ms4a3 gene by CRISPR-Cas9 technique in C57BL/6 zygotes.