B6;CBA-Gt(ROSA)26Sor^{em1(CAG-Ikzf2,-tdTomato)Zyliu}/J

Stock number: 036272
Product name: Rosa26-CAG-LSL-Ikzf2
Research areas: Neurobiology Research, Research Tools, Sensorineural Research

Description

CRISPR/Cas9 generated Rosa26-CAG-LSL-Ikzf2/+ mice contain a Cre-inducible 3xHA C-terminal tagged Ikzf2 gene fused to a T2A-tdTomato sequence inserted into the Gt(ROSA)26Sor locus. These mice are useful for lineage tracing, cell sorting, and gene manipulation of multiple cell types including cochlear hair cells (HCs).

Detailed description

CRISPR/Cas9 generated Rosa26-CAG-LSL-Ikzf2/+ mice contain a Cre-inducible 3xHA C-terminal tagged IKAROS family zinc finger 2 (Ikzf2) gene fused to a T2A-tdTomato sequence inserted into the Gt(ROSA)26Sor locus. Ikzf2 encodes a hematopoietic-specific transcription factor involved in the regulation of lymphocyte development that is also necessary for outer hair cell (OHC) development. Homozygous mice are viable and fertile. In the absence of Cre, Ikzf2 and tdTomato expression is prevented by the STOP cassette. After removal of the loxP-flanked STOP cassette via cre-mediated recombination, Ikzf2 and tdTomato are initially translated together from the same polycistronic mRNA, and are subsequently separated by the 2A peptide. Once triggered, the expression of Ikzf2 and tdTomato is permanent, which enables genetic fate-mapping analysis at single-cell resolution in cre-expressing tissues of the offspring.

Development

Plasmids encoding a guide RNA (ACTCCAGTCTTTCTAGAAGA) were designed to insert a cassette encoding a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG) followed by a floxed STOP cassette and a 3xHA (hemaglutinin) C-terminal tagged IKAROS family zinc finger 2 (Ikzf2) gene into the Gt(ROSA)26Sor locus. A viral 2A oligopeptide (T2A) self cleaving peptide, that mediates ribosomal skipping, fused to a red fluorescent protein sequence (tdTomato) was inserted downstream. sgRNA, the cas9 mRNA, and a donor plasmid were introduced into the cytoplasm of C57BL/6NCrl-derived fertilized eggs with well recognized pronuclei. Injected embryos were transferred to pseudopregnant females. Resulting Rosa26-CAG-LSL-Ikzf2/+ F0 mice were screened by tail PCR. The F0 mice, with potential correct targeting, were further bred to C57BL/6NCrl mice for one generation for germ line transmission to develop the germ line stable colony. These F1 mice were further subject to PCR and Southern blot. Single male F1 mice, which had no random insertion of gene targeting vector, was chosen for colony expanding. Mice were further bred to C57BL/6NCrl mice for four generations by the donating laboratory (see SNP note below). Since this strain was used to generate compound genetic mutants, the mice sent to The Jackson Laboratory were on a mixed background of C57BL6/NCrl and CBA, so they were no longer on a pure genetic background. Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6NJ oocytes (Stock No. 005304).

In 2021, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the males sent to The Jackson Laboratory Repository. All 5 of the markers that determine C57BL/6J from C57BL/6N were found to be C57BL/6J. As such, after rederivation, this mouse colony was built by breeding to C57BL/6J mice. Thus, this colony is on a mixed C57BL/6J ; C57BL/6N genetic background.

Allele

Symbol: Gt(ROSA)26Sor^{em1(CAG-Ikzf2,-tdTomato)Zyliu}
Name: endonuclease-mediated mutation 1, Zhiyong Liu
MGI accession ID: MGI:6515768
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed); Reporter; Inserted expressed sequence; Epitope tag
Synonyms: Rosa26-CAG-Loxp-stop-Loxp-Ikzf2*3xHA-T2A-Tdtomato; Rosa26-CAG-LSL-Ikzf2
Marker symbol: Gt(ROSA)26Sor
Marker name: gene trap ROSA 26, Philippe Soriano
Marker synonyms: beta geo; Gtrgeo26; Gtrosa26; R26; ROSA26; SETD5-AS1; Thumpd3as1
Chromosome: 6
Strain of origin: C57BL/6NCrl
Molecular note: Plasmids encoding a guide RNA (ACTCCAGTCTTTCTAGAAGA) were designed to insert a cassette encoding a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG) followed by a floxed STOP cassette and a 3xHA (hemaglutinin) C-terminal tagged Ikzf2 gene into the Gt(ROSA)26Sor locus. A viral 2A oligopeptide (T2A) self cleaving peptide, that mediates ribosomal skipping, fused to a red fluorescent protein sequence (tdTomato) was inserted downstream.