C57BL/6-Slc26a5^{em1(HBEGF)Zyliu}/J

Stock number: 036271
Product name: Prestin-DTR
Research areas: Neurobiology Research, Research Tools, Sensorineural Research

Description

CRISPR/Cas9 generated Prestin-DTR/+ mice express P2A-DTR directed from the endogenous solute carrier family 26, member 5 (Slc26a5) promoter. They are useful for applications requiring diphtheria-mediated ablation of cochlear outer hair cells (OHCs).

Detailed description

CRISPR/Cas9 generated Prestin-DTR/+ mice express P2A-DTR directed from the endogenous solute carrier family 26, member 5 (Slc26a5) promoter. Prestin encodes a transmembrane motor protein expressed in motile outer hair cells (OHCs) of the cochlea that functions at microsecond rates to convert sounds to changes in the cellular length of OHCs. Homozygous mice are viable and fertile, and endogenous Prestin expression is intact. Prior to diptheria toxin (DT) treatment, co-staining for the OHC-marker Prestin and the inner hair cell (IHC) marker vGlut3 revealed that OHCs are normal in Prestin-DTR/+ mice. One injection of DT at P36 specifically depletes OHCs by P42.

Development

sgRNA (CGAGGCATAAAGGCCCTGTA) was designed to insert a P2A self-cleaving peptide, that mediates ribosomal skipping, followed by a human diphtheria toxin receptor (DTR) immediately upstream of the endogenous stop codon of the solute carrier family 26, member 5 (Slc26a5) gene. sgRNA and the cas9 nuclease were introduced into the cytoplasm of C57BL/6NCrl-derived fertilized eggs with well recognized pronuclei. Injected embryos were transferred to pseudopregnant females. Resulting Prestin-DTR/+ F0 mice were screened by tail PCR. The F0 mice, with potential correct targeting, were further bred to C57BL/6NCrl mice for one generation for germ line transmission to develop the germ line stable colony. These F1 mice were further subject to PCR and Southern blot. Single male F1 mice, which had no random insertion of gene targeting vector, was chosen for colony expanding. Mice were further bred to C57BL/6NCrl mice for four generations by the donating laboratory (see SNP note below). Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6NJ oocytes (Stock No. 005304).

In 2021, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the males sent to The Jackson Laboratory Repository. All 5 of the markers that determine C57BL/6J from C57BL/6N were found to be C57BL/6J. As such, after rederivation, this mouse colony was built by breeding to C57BL/6J mice. Thus, this colony is on a mixed C57BL/6J ; C57BL/6N genetic background.

Allele

Symbol: Slc26a5^{em1(HBEGF)Zyliu}
Name: endonuclease-mediated mutation 1, Zhiyong Liu
MGI accession ID: MGI:6515764
Generation method: Endonuclease-mediated
Attributes: Inserted expressed sequence
Synonyms: Prestin-DTR; Prestin-P2A-DTR
Marker symbol: Slc26a5
Marker name: solute carrier family 26, member 5
Marker synonyms: DFNB61; Pres; prestin
Chromosome: 5
Strain of origin: C57BL/6NCr
Molecular note: Plasmids encoding a guide RNA (CGAGGCATAAAGGCCCTGTA) are designed to insert a viral 2A oligopeptide (P2A) self cleaving peptide, that mediates ribosomal skipping, followed by a human diphtheria toxin receptor (DTR) immediately upstream of the endogenous stop codon.