B6;FVB-Nts^em1Evdr/J

Stock number: 036262
Research areas: Diabetes and Obesity Research, Neurobiology Research, Research Tools

Description

Nts^flox mice have loxP sites flanking exon 4 of the neurotensin gene. Exposure to Cre recombinase removes the floxed sequence - creating a null allele. These Nts^flox mice may be useful in studying obesity and metabolism.

Detailed description

The Nts gene encodes a pro-hormone that is subsequently cleaved to form a 13-amino acid peptide called Neurotensin and a 6-amino acid peptide called Neuromedin N. Neurotensin has been linked to many functions, including nociception, appetite, inflammation, and adipose thermogenesis.

The Nts^flox allele has loxP sites flanking exon 4 of the Nts gene. Prior to introduction of Cre recombinase, mice heterozygous or homozygous for the Nts^flox allele are viable and fertile with normal breeding, and have no gross physical or behavioral abnormalities.

When Nts^flox mice are bred to mice that express Cre recombinase, the resulting offspring will have exon 4 deleted - creating a null allele in the cells/tissues as determined by the Cre promoter. Both Neurotensin and Neuromedin N are ablated following recombination.
For example, when Nts^flox mice are crossed to Prox1-CreERT2 (Stock No. 022075) mice to generate tamoxifen inducible, lymphatic endothelial cell (LEC)-specific NTS knock-out mice, the resulting mice display reduced Nts mRNA expression in brown adipose tissue (BAT). They also exhibit elevated thermogenic gene expression and UCP-1 protein levels in BAT at thermoneutrality. Finally, these LEC-specific NTS KO mice display reduced BAT lipid content at 30°C, and increased cold tolerance (Li et al., Cell Metab. 2021).

Development

The Nts floxed allele (also called Nts^flox) was created in the laboratory of Dr. Evan Rosen (Harvard Medical School) using CRISPR/Cas9 technology.
First, guide RNAs surrounding exon 4 of the neurotensin locus (Nts) on chromosome 10 were selected (GCCACAGAGATACCCCGTGGA and TCTAAGGATAACTTGAGAAT) and synthesized along with a single-stranded DNA repair template designed to insert loxP sites flanking exon 4. The plasmid was microinjected into FVB/N zygotes along with cas9 enzyme. Founder mice were interbred for germline transmission of the allele. The resulting Nts^flox colony was then backcrossed to C57BL/6J mice for at least 10 generations prior to sending males to The Jackson Laboratory Repository in 2021 (see SNP note below). Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. 000664).

In 2021, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the males sent to The Jackson Laboratory Repository. Many of the 43 markers throughout the genome were segregating with FVB, suggesting an incomplete backcross.



Of note, the donating investigator reports that the Y chromosome may not have been fixed to the C57BL/6J background during backcrossing.

Allele

Symbol: Nts^em1Evdr
Name: endonuclease-mediated mutation 1, Evan Rosen
MGI accession ID: MGI:6695296
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed)
Synonyms: Nts^flox
Marker symbol: Nts
Marker name: neurotensin
Marker synonyms: 5033428E16Rik; neuromedin N; NMN-125; NN; NT; NT/N; NTS1
Chromosome: 10
Strain of origin: FVB/N
Molecular note: CRISPR/cas9 genome editing is used to insert loxP sites flanking exon 4.