B6.Cg-Gt(ROSA)26Sor^{em2(CAG-tdTomato)Jahe}/Mmjax

Stock number: 036251
Product name: Ai9-Cas12a , NCFP
Research areas: Neurobiology Research, Research Tools

Description

Ai9-Cas12a or NCFP is a conditional tdTomato reporter (Ai9) modified such that single guide RNA for Acidaminococcus sp. or Lachnospiraceae sp. Cas12a can be used to mediate deletion of the stop cassette by non-homologous end joining and activate tdTomato expression. This strain was developed as an in vivo fluorescent reporter platform for CRISPR/Cas12a/RNA-Guided Nuclease (RGN) genome editing activity.

Detailed description

Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sor^{tm9(CAG-tdTomato)Hze} (commonly referred to as Ai9; JAX Stock No. 007909) was modified to duplicate the guide target sequences for Acidaminococcus sp., and Lachnospiraceae sp. cas12a found on the 5' end of the loxP-flanked stop cassette onto the 3' end of the stop cassette. With this modification, a single guide RNA for Acidaminococcus sp. or Lachnospiraceae sp.Cas12a can be used to mediate deletion of the stop cassette by non-homologous end joining and activate tdTomato expression. The donating investigator indicates that it is believed that the remaining sequence is not sufficient for cre-mediated recombination with the 5' loxP site. Mice homozygous for Ai9-Cas12a or NCFP are viable and fertile. Tint from the fluorochromes may be visually apparent on furless skin. This strain was developed as an in vivo fluorescent reporter platform for CRISPR/Cas12a/RNA-Guided Nuclease (RGN) genome editing activity.

Please note: A similar model using Cas9 is available as B6.Cg-Gt(ROSA)26Sor^{em1(CAG-tdTomato)Jahe}/Mmjax (Stock No. 068227).

Development

CRISPR/Cas9 genome-editing was used to modify embryos from B6.Cg-Gt(ROSA)26Sor^{tm9(CAG-tdTomato)Hze}/J (JAX Stock No. 007909; Ai9). Guide target sequences for Acidaminococcus sp., and Lachnospiraceae sp. Cas12a found on the 5' end of the loxP-flanked stop cassette [5'(PAM TTTG) GCAAAGAATTGATTTGATACCGC] are duplicated onto the 3' end of the stop cassette. The modification of Ai9 leads to the partial deletion of the loxP site on the 3' end of the stop cassette. Founder mice with the Ai9-Cas12a allele were identified by PCR and sequencing. Founders were bred to C57BL/6J mice for germline transmission further backcrossed to C57BL/6J for an additional 3 generations by the donating laboratory (see SNP note below). The strain was then bred to homozygosity. Upon arrival, mice were bred to C57BL/6J for at least 1 generation to establish the colony.

In 2021, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the males sent to The Jackson Laboratory Repository. One of the 5 markers that determine C57BL/6J from C57BL/6N were found to be segregating. These data suggest the mice sent to The Jackson Laboratory Repository were on a mixed C57BL/6N;C57BL/6J genetic background.

Allele

Symbol: Gt(ROSA)26Sor^{em2(CAG-tdTomato)Jahe}
Name: endonuclease-mediated mutation 2, Jason Heaney
MGI accession ID: MGI:6508540
Generation method: Endonuclease-mediated
Attributes: Reporter
Synonyms: Ai9-Cas12a
Marker symbol: Gt(ROSA)26Sor
Marker name: gene trap ROSA 26, Philippe Soriano
Marker synonyms: beta geo; Gtrgeo26; Gtrosa26; R26; ROSA26; SETD5-AS1; Thumpd3as1
Chromosome: 6
Strain of origin: B6.Cg-Gt(ROSA)26Sor^{tm9(CAG-tdTomato)Hze}/J
Molecular note: CRISPR/Cas9 editing of Gt(ROSA)26Sor^{tm9(CAG-tdTomato)Hze} (Ai9) was modified to duplicate a guide target sequences for A.s. and L.b. Cas12a found on the 5' end of the loxP-flanked stop cassette [5'(PAM TTTG) GCAAAGAATTGATTTGATACCGC] onto the 3' end of the stop cassette. With this modification, a single guide RNA for A.s. or L.b. Cas12a can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression. CRISPR-modification of Ai9 lead to the partial deletion of the loxP site on the 3' end of the stop cassette. It is believed that the remaining sequence is not sufficient for Cre-mediated recombination with the 5' loxP site.
General note: This allele was generated from Gt(ROSA)26Sor^{tm9(CAG-tdTomato)Hze}.