B6.Cg-Gt(ROSA)26Sor^{em1(CAG-tdTomato)Jahe}/Mmjax

Stock number: 036250
Product name: Ai9-SauSpyCas9 , NSPB
Research areas: Neurobiology Research, Research Tools

Detailed description

Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sor^{tm9(CAG-tdTomato)Hze} (commonly referred to as Ai9; JAX Stock No. 007909) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus cas9 found on the 3' end of the loxP-flanked stop cassette onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activate tdTomato expression. Mice homozygous for Ai9-SauSpyCas9 or NSPB are viable and fertile. Tint from the fluorochromes may be visually apparent on furless skin. This strain was developed as an in vivo fluorescent reporter platform for CRISPR/Cas9/RNA-Guided Nuclease (RGN) genome editing activity.

Please note: A similar model using Cas12a is available as B6.Cg-Gt(ROSA)26Sor^{em2(CAG-tdTomato)Jahe}/Mmjax (Stock No. 068228).

Development

CRISPR/Cas9 genome-editing was used to modify embryos from B6.Cg-Gt(ROSA)26Sor^{tm9(CAG-tdTomato)Hze}/J (JAX Stock No. 007909; Ai9). Guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTATT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] are duplicated onto the 5' end of the stop cassette. Founder mice with the Ai9-SauSpyCas9 allele were identified by PCR and sequencing. Founders were bred to C57BL/6J mice for germline transmission and further backcrossed to C57BL/6J for an additional 3 generations. The strain was then bred to homozygosity. Upon arrival, mice were bred to C57BL/6J for at least 1 generation to establish the colony.

Allele

Symbol: Gt(ROSA)26Sor^{em1(CAG-tdTomato)Jahe}
Name: endonuclease-mediated mutation 1, Jason Heaney
MGI accession ID: MGI:6507752
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed); Reporter
Synonyms: Ai9-SauSpyCas9
Marker symbol: Gt(ROSA)26Sor
Marker name: gene trap ROSA 26, Philippe Soriano
Marker synonyms: beta geo; Gtrgeo26; Gtrosa26; R26; ROSA26; SETD5-AS1; Thumpd3as1
Chromosome: 6
Strain of origin: B6.Cg-Gt(ROSA)26Sor^{tm9(CAG-tdTomato)Hze}/J
Molecular note: Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sor^{tm9(CAG-tdTomato)Hze} (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTATT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression.
General note: This allele was generated from Gt(ROSA)26Sor^{tm9(CAG-tdTomato)Hze}.