B6.Cg-Gba1^em1Mcook/J

Stock number: 036159
Product name: Gba^E326K
Research areas: Neurobiology Research

Description

Gba1^E326K mice carry a CRISPR/Cas9-generated E344K knock-in in exon 8 of the mouse Gba1 (glucosidase, beta, acid 1) gene. This mutation corresponds to a human coding variant potentially associated with increased susceptibility to familial Parkinson's disease. Homozygotes show ~30-40% reduction in glucocerebrosidase (GCase) activity in whole brain tissue as well as a decrease in the total protein.

Detailed description

The E326K coding variant (current nomenclature E365K) of the human GBA1 (glucosidase, beta, acid 1) gene on chromosome 1q22 is potentially associated with increased susceptibility to familial Parkinson's disease (PMID:28830825).

Gba1^E326K mice carry a corresponding E344K (GAG to AAG) knock-in and 2 silent mutations in exon 8 of the mouse Gba1 gene. Homozygotes show ~30-40% reduction in GCase activity in whole brain tissue as well as a decrease in the total protein. They are viable and fertile and without overt phenotype.

This strain has not as yet been published and studies are ongoing. We will update this description as more information becomes known. (February, 2022)

Distribution of this strain was supported by the Michael J. Fox Foundation for Parkinson's Research.

Development

Exon 8 (NM_001077411.4) of the mouse Gba1 gene was modified using CRISPR/Cas9 methodologies to incorporate an E344K (GAG->AAG) knock-in (bold) and 3 silent mutations (lower case): wildtype CCAAAGCTACTTTAGGAGAGACA to mutant CtAAgGCcACTTTAGGAAAGACA. SgRNA TGTCTCTCCTAAAGTAGCTT, donor DNA, and Cas9 mRNA were injected into hybrid embryos (MF1 outbred ; C57BL/6 inbred). The donating investigator reported that the resultant mice were backcrossed to C57BL/6J for more than 8 generations (see SNP note below). The donating laboratory sent 2 homozygous males (black coat color) to The Jackson Laboratory in 2022. Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. 000664).

In 2022, a high-density single nucleotide polymorphism (~9000 SNP) analysis was performed on the 2 males sent to The Jackson Laboratory. These data showed ~97-99% C57BL/6 markers (~89-92% C57BL/6J ; ~7-8% C57BL/6NCrl). The remaining 1-3% of the markers were of unknown origin, which may represent MF1 outbred contribution from the embryos used in creating the mice.
Of note, the same 2 males were also tested using our routine 48 SNP panel (43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains). This showed all 48 markers to be C57BL/6J.

Allele

Symbol: Gba1^em1Mcook
Name: endonuclease-mediated mutation 1, Mark Cookson
MGI accession ID: MGI:6867816
Generation method: Endonuclease-mediated
Attributes: Humanized sequence
Synonyms: Gba^E326K
Marker symbol: Gba1
Marker name: glucosylceramidase beta 1
Marker synonyms: betaGC; GBA; GBA1; GC; GCase; GCB; GLUC; glucocerebrosidase
Chromosome: 3
Strain of origin: MF1 x C57BL/6
Molecular note: CRISPR/Cas9 methodologies is used to incorporate an E344K (also designated E326K) (GAG to AAG) knock-in in exon 8 (NM_001077411.4) and 2 silent mutations: wildtype CCAAAGCTACTTTAGGAGAGACA to mutant CtAAgGCcACTTTAGGAAAGACA. This mutation corresponds to a human coding variant potentially associated with increased susceptibility to familial Parkinson’s disease.