B6N;C3Fe-Iqsec2^em1Frk/J

Stock number: 035784
Product name: Iqsec2 KO

Research areas: Mouse/Human Gene Homologs, Neurobiology Research

Description

Iqsec2 KO mice carry a CRISPR/Cas9 generated thymine deletion at position 2579 in exon 7 (del2579T) of the X-linked IQ motif and Sec7 domain 2 (Iqsec2) gene, resulting in a frame shift and a premature stop codon. These mice may be useful when studying altered excitatory neuronal transmission associated with epilepsy, epileptic encephalopathy, intellectual disability, and autism spectrum disorder.

Detailed description

Iqsec2 KO mice carry a CRISPR/Cas9 generated thymine deletion at position 2579 in exon 7 (del2579T) of the X-linked IQ motif and Sec7 domain 2 (Iqsec2) gene, resulting in a frame shift and a premature stop codon. This gene encodes a guanine nucleotide exchange factor for the ARF family of small GTP-binding proteins. It is a component of the postsynaptic density at excitatory synapses, and may play a critical role in cytoskeletal and synaptic organization. Mutations are associated with multiple cases of X-linked epileptic encephalopathy (XLEE) and X-linked intellectual disability (XLID) characterized by seizures, developmental regression, language development delay, intellectual disability, and autism.

In these mice, Western blot shows absence of protein in the brain of hemizygous KO males. Most hemizygous males, and a few heterozygous females, have lethal tonic-clonic seizures with onset between 21-90 days of age. They exhibit altered seizure susceptibility, developmental and behavioral abnormalities, hippocampus-specific reactive gliosis, increased excitatory transmission onto hippocampal interneurons, and atypical expression of hippocampal fast-spiking parvalbumin interneurons. They are also hyperanxious, hyperactive, have impaired social interactions, and various cellular and electrophysiological abnormalities.

Development

A guide RNA (AGCGACTCATTGAAGCTTTCAGG) was designed to introduce a thymine deletion at position 2579 in exon 7 (del2579T) of the X-linked IQ motif and Sec7 domain 2 (Iqsec2) gene, resulting in a frame shift and a premature stop codon. It is unknown if there are any off-target sites present. sgRNA and the cas9 nuclease were introduced into the cytoplasm of C57BL/6NJ-derived fertilized eggs with well recognized pronuclei. Correctly targeted embryos were transferred to pseudopregnant females. Iqsec2 KO pups were identified by PCR and further bred to C57BL/6NJ mice to develop the colony. Sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C3HeB/FeJ oocytes (Stock No. 000658). For optimizing fecundity and maternal care, the donating investigator suggests that mice be maintained on a mixed genetic background of C3HeB/FeJ x B6NJ due to poor maternal care on a congenic C57BL/6 background.

Allele

Symbol: Iqsec2^em1Frk
Name: endonuclease-mediated mutation 1, Wayne N Frankel
MGI accession ID: MGI:6392157
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Marker symbol: Iqsec2
Marker name: IQ motif and Sec7 domain 2
Marker synonyms: BRAG1; IQ-ArfGEF; MRX1; MRX18; MRX78; NEDXSB; RGD1562109; XLID1
Chromosome: X
Strain of origin: C57BL/6NJ
Molecular note: This CRISPR/Cas9 mediated deletion of a single nucleotide T at position 2579, in exon 7, results in a a phenylalanine to serine mutation at amino acid 860 which causes a frameshift mutation that introduces a stop codon. Semi-quantatative PCR and Western blot analysis indicate this is a null allele.