B6.129-Per2^em1Vrshp/J

Stock number: 035520
Product name: PER2-S478A::LUC
Research areas: Neurobiology Research

Description

Per2-S478A::Luc mice reporter mutant mice express PER2-S478A and luciferase bioluminescence similar to endogenous Per2 expression, and may be useful as a real-time reporter of circadian dynamics.

Detailed description

PER2 encodes a transcriptional repressor which forms a core component of the circadian clock. The circadian clock is an internal time-keeping system which regulates various physiological processes through the generation of approximately 24 hour circadian rhythms in gene expression, which are translated into rhythms in metabolism and behavior. The speed of the circadian clock is regulated by phosphorylation-regulated degradation of the PER2 protein.

CRISPR/cas9 endonuclease mediated genome editing of the β-TrCP site of the period circadian clock 2 (Per2) gene was used to create an S478A mutation in mPer2^Luc mutant mice (Stock No. 006852) resulting in these Per2-S478A::Luc mice. In these mice, the mutant PER2-S478A protein is stabilized in the mouse liver, and the mutation causes lengthening of the circadian period of mouse behavioral rhythms. Homozygous mice are viable and fertile.

Of note, Per2-S478A mice, lacking the luciferase sequence, were also generated and are available as Stock No. 035521.

Development

A targeting vector was designed to insert the firefly luciferase (luc) gene followed by an in-frame loxP-flanked neomycin resistance gene between exon 23 and the 3' UTR of the period circadian clock 2 (Per2) gene. The construct was electroporated into 129S6/SvEvTac-derived W4 embryonic stem (ES) cells. Correctly targeted ES cells were injected into C57BL/6J blastocysts. Chimeric males were bred to C57BL/6J females. Heterozygotes were backcrossed to C57BL/6J inbred mice for 7-11 generations and are available as Stock No. 006852. Some of these mPer2^Luc mice were sent to Dr. David Virshup (Duke-NUS Medical School). Embryos were produced by fertilizing C57BL/6J oocytes with sperm from mPer2^Luc males.

A guide RNA (GCGGCTCCAGTGGCTAT) was designed for genome editing in embryos and a donor oligonucleotide (Per2-S478A-T; CTTCTACACCTTTCTATGTGCTTTCCCCCCAGCCTGTCCCCCACAGCGGCTCAGCTGGCTATGGGAGCCTGGGCAGTAACGGATCCCACGAACACCTCATGAGCCAGA) was used as a donor for the TCC AGT to TCA GCT mutations in codons 477 and 478, resulting in the insertion of a serine to alanine point mutation in codon 478 (S478A) in the Per2 gene. The guide RNA, donor oligonucleotide, and the Cas9 nuclease were introduced into the cytoplasm of C57BL/6J; mPer2^Luc derived embryos with well recognized pronuclei. Correctly targeted embryos were transferred to pseudopregnant females and offspring were screened by PCR and sequencing. Founders harboring the Per2^S478A allele were mated to C57BL/6J females for germline transmission of the targeted allele and to determine if the targeted allele was in cis with the luciferase knock-in. Since the Per2^luc allele was produced by gene targeting in embryonic stem cells from strain 129, the Per2 locus in the embryos was heterozygous with 129-derived and C57BL/6J-derived alleles. PCR amplicon sequencing was used to distinguish the 129 and C57BL/6J alleles and founders with the S478A allele inserted in cis with luciferase in the 129 allele were used to establish this combined Per2-S478A::Luc strain. Mice were further backcrossed to C57BL/6NTac mice for at least 14 generations by the donating laboratory (see SNP note below). Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6NJ oocytes (Stock No. 005304).

In 2021, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the males sent to The Jackson Laboratory Repository. Four of the 5 markers that determine C57BL/6J from C57BL/6N were found to be segregating, including the rd8 recessive mutation associated with retinal degeneration on Chromosome 1 within the Crb1 locus. These data suggest the mice sent to The Jackson Laboratory Repository were on a mixed C57BL/6N;C57BL/6J genetic background.

Allele

Symbol: Per2^em1Vrshp
Name: endonuclease-mediated mutation 1, David Virshup
MGI accession ID: MGI:6453858
Generation method: Endonuclease-mediated
Attributes: Reporter
Synonyms: PER2-S478A::LUC; S478A-Luc
Marker symbol: Per2
Marker name: period circadian clock 2
Marker synonyms: FASPS; FASPS1; mKIAA0347; mPer2; rPER2
Chromosome: 1
Strain of origin: 129S6/SvEvTac
Site of expression: Liver.
Molecular note: CRISPR/Cas9 genome editing was used to insert TCC AGT to TCA GCT mutations in codons 477 and 478, resulting in the insertion of a serine to alanine point mutation in codon 478 (S478A). TGuide RNA, donor oligonucleotide, and the Cas9 nuclease were introduced into the cytoplasm of embryos derived from a cross of C57BL/6J males and Per2^tm1Jt-derived embryos with well recognized pronuclei. PCR amplicon sequencing was used to distinguish between the 129 and C57BL/6J alleles and founders with the S478A allele inserted in cis with Per2^tm1Jt in the 129 allele were selected. This allele includes the S478A mutation and a luciferase gene and floxed neo cassette inserted between exon 23 and the 3' UTR.