C57BL/6J-Abcb1a^em1Sbkv/SndrdJ

Stock number: 035456
Product name: Abcb1a^ametrine
Strain synonyms: Abcb1a^AME
Research areas: Internal/Organ Research, Research Tools

Description

Abcb1a^ametrine mice express the ametrine fluorescent reporter sequence directed from the endogenous ATP-binding cassette, sub-family B (MDR/TAP), member 1A (Abcb1a) promoter. They are useful for visualizing MDR1 expressing cells, and for studying T cell-mediated immunity and inflammation, as well as regulation of oxidative stress.

Detailed description

Abcb1a^ametrine mice express the ametrine fluorescent reporter sequence directed from the endogenous ATP-binding cassette, sub-family B (MDR/TAP), member 1A (Abcb1a) promoter. The presence of a P2A sequence allows for stoichiometric expression of Abcb1a and ametrine proteins. Also known as Mdr1a, Abcb1a encodes a membrane-associated, ATP-dependent efflux pump recognized for transporting chemotherapeutic drugs out of tumor cells. Loss of Abcb1a in FVB/N-derived mice has also been associated with the onset of spontaneous colitis. Ametrine fluorescence is detectable via fluorescence-activated cell sorting (FACS), immunohistochemistry, and direct fluorescence. These mice display increased expression of MDR1 in mucosal CD4+ T effector (Teff) cells in the small intestine lamina propria (siLP), as well as in circulating cytotoxic lymphocytes, including CD8+ T cells and natural killer (NK) cells. Homozygous mice are viable and fertile.

Development

Plasmids encoding guide RNAs (5'-GCUUCUCAAUGGUCAGUGUGCUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3'; and 5'-GAAAAUACUUAACAUCUUACAUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3') were designed to replace the endogenous stop codon of the ATP-binding cassette, sub-family B (MDR/TAP), member 1A (Abcb1a) gene with a P2A sequence (to mediate ribosomal skipping) fused to an ametrine fluorescent reporter sequence and a stop codon. Base pair substitutions were also introduced in order to eliminate the Cas9 PAM sequence to prevent retargeting. gRNAs and the cas9 nuclease were introduced into the cytoplasm of C57BL/6J-derived fertilized eggs with well recognized pronuclei. Correctly targeted embryos were transferred to pseudopregnant females. Abcb1a^ametrine mice were identified by PCR. Mice were further bred to C57BL/6J mice for 10 generations to develop the colony. Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. 000664).

Allele

Symbol: Abcb1a^em1Sbkv
Name: endonuclease-mediated mutation 1, Sergei B Koralov
MGI accession ID: MGI:6437907
Generation method: Endonuclease-mediated
Attributes: Reporter
Synonyms: Abcb1a^AME; Abcb1a^ametrine
Marker symbol: Abcb1a
Marker name: ATP-binding cassette, sub-family B (MDR/TAP), member 1A
Marker synonyms: ABC20; CD243; CLCS; ENPAT; Evi32; GP170; MDR1; Mdr1a; MDR3; mdr-3; multiple drug resistant 1a; p-170; P-glycoprotein; Pgp; P-gp; PGY1; Pgy3; Pgy-3
Chromosome: 5
Strain of origin: Not Specified
Molecular note: CRISPR/Cas9 genome editing is used to replace the stop codon with a bicistronic reporter containing a P2A peptide sequence and the fluorescent reporter ametrine. In addition, an in-frame 9 nucleotide deletion is found near the 3' end of the gene. The deletion is not believed to affect protein expression. Ametrine is a long stokes shift (excitation at 406 nanometers and emission at 526 nanometers) yellow fluorescent protein derived from Aequorea victoria.