B6;FVB-Uts2b^em1(cre)Zak/J

Stock number: 035452
Product name: Uts2b^Cre, Uts2b^2A-Cre
Research areas: Research Tools

Description

Uts2b^Cre (Uts2b^2A-Cre) mice express a CRISPR/Cas9-generated T2A-cre recombinase knock-in from the mouse Uts2b (urotensin 2B) promoter. Reporters indicate that cre expression patterns are identical to those of the endogenous Uts2b gene based on in situ hybridization (ISH) results available through the Allen Brain Institute. This strain has been useful in the mapping of vagal sensory neurons in the intestine.

Detailed description

Uts2b (urotensin 2B) is a marker for a subset of cells that broadly innervate the intestine. Uts2b^Cre (Uts2b^2A-Cre) mice express a CRISPR/Cas9-generated T2A-cre recombinase knock-in from the mouse Uts2b promoter. The T2A oligopeptide mediates ribosomal skipping and is derived from foot-and-mouth disease virus 2A from the insect Thosea asigna virus. Reporters indicate that cre expression patterns are identical to those of the endogenous Uts2b gene based on in situ hybridization (ISH) results available through the Allen Brain Institute. Mucosal ending neurons expressing Uts2b exclusively innervate the intestinal villi and are distributed across the proximal, middle and distal intestine. This strain has been useful in the mapping of vagal sensory neurons in the intestine.

Development

The Uts2b^Cre (Uts2b^2A-Cre) allele was generated by homologous recombination at the endogenous Uts2b locus, aided by targeted CRISPR endonuclease activity. Briefly, a sgRNA (TGTTTCAAGCTCTAAGAAACTG) was selected to introduce CRISPR double strand breaks within the 3’UTR. The targeting vector contained a T2A-Cre cassette inserted immediately upstream of the endogenous stop codon, a 1kb upstream homology arm, and a 2kb downstream homology arm with a TG to GT mutation introduced into the 3’UTR (114-115bp after stop codon) to avoid cleavage by the sgRNA. The T2A oligopeptide mediates ribosomal skipping and is derived from foot-and-mouth disease virus 2A from the insect Thosea asigna virus. T2A permits cre recombinase to be expressed in frame with Uts2b as a separate polypeptide. Cas9 protein, sgRNA, and targeting vector DNA were mixed and injected into the pronucleus of fertilized FVB/N zygotes. This strain was backcrossed to C57BL/6J for 5 generations by the donating laboratory (see SNP note below). Cryopreservation and rederivation at The Jackson Laboratory will involve the use of C57BL/6J.

In 2020, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the rederived living colony at The Jackson Laboratory Repository. Many of the 43 markers throughout the genome were segregating with FVB, suggesting an incomplete backcross. Also, three of the 5 markers that determine C57BL/6J from C57BL/6N were found to be segregating, on Chromosomes 8, 15, and the rd8 recessive mutation associated with retinal degeneration on Chromosome 1 within the Crb1 locus. These data suggest the mice sent to The Jackson Laboratory Repository were on a mixed C57BL/6N;C57BL/6J genetic background.

Allele

Symbol: Uts2b^em1(cre)Zak
Name: endonuclease-mediated mutation 1, Zachary Knight
MGI accession ID: MGI:6448061
Generation method: Endonuclease-mediated
Attributes: Recombinase-expressing
Synonyms: Uts2b^2A-Cre; Uts2b^cre
Marker symbol: Uts2b
Marker name: urotensin 2B
Marker synonyms: U2B; UIIB; U-IIB; Urp; UTS2D
Chromosome: 16
Strain of origin: FVB/N
Molecular note: CRISPR/Cas9 genome editing is used to insert a T2A-Cre cassette immediately upstream of the endogenous stop codon, a 1kb upstream homology arm, and a 2kb downstream homology arm with a TG to GT mutation introduced into the 3' UTR (114-115bp after stop codon) to avoid cleavage by the sgRNA. The T2A oligopeptide mediates ribosomal skipping and is derived from foot-and-mouth disease virus 2A from the insect Thosea asigna virus. T2A permits cre recombinase to be expressed in frame with Uts2b as a separate polypeptide.