B6;SJL-Cacna2d4^em1Leea/J

Stock number: 035183
Product name: α₂δ-4 KO
Research areas: Developmental Biology Research, Sensorineural Research

Description

α₂δ-4 KO mice carry a CRISPR/Cas9 generated an out-of-frame deletion (c.360_408del) in exon 2 of the calcium channel, voltage-dependent, alpha 2/delta subunit 4 (Cacna2d4) gene. This strain useful when studying the role of α₂δ-4 in organizing the structure and function of photoreceptor synapses.

Detailed description

α₂δ-4 KO mice carry a CRISPR/Cas9 generated out-of-frame deletion (c.360_408del) in exon 2 of the calcium channel, voltage-dependent, alpha 2/delta subunit 4 (Cacna2d4) gene. This gene encodes α₂δ-4, a subunit of voltage-gated Ca_v1.4 L-type channels that regulate the development and mature exocytotic function of the photoreceptor ribbon synapse. Mutations in this gene cause heterogeneous forms of vision impairment in humans.

In these α₂δ-4 KO mice, rod spherules lack ribbons and other synaptic hallmarks early in development. Although the molecular organization of cone synapses is less affected than rod synapses, horizontal and cone bipolar processes extend abnormally in the outer nuclear layer in knock-out retina. The severity of the synaptic defects in these knock-out mice correlates with a progressive loss of Ca_v1.4, first in terminals of rods and later cones. These knock-out mice demonstrate the role of this subunit in organizing the structure and function of photoreceptor synapses. This subunit is also required to maintain the presynaptic density of Ca_v1.4 channels in rods and rod synapse structure.

Of note, a similar strain, Stock No. 031377, lacking exon 2, exhibits abnormal behavior and hyperactivity, suggesting a neural phenotype associated with this gene.

Development

Plasmids encoding guide RNAs (AACACGGTGACCAGATATTC and CAGATTCCTGCCGAAGGTAT) were designed to introduce an out-of-frame deletion (c.360_408del) in exon 2 of the calcium channel, voltage-dependent, alpha 2/delta subunit 4 (Cacna2d4) gene. This mutation results in a premature translational stop codon after 14 novel codons. It is unknown if there are any off-target sites present. sgRNAs and the cas9 nuclease were introduced into the cytoplasm of C57BL/6JxB6SJLF1/J-derived fertilized eggs with well recognized pronuclei. Correctly targeted embryos were transferred to pseudopregnant females. α₂δ-4 KO pups were identified by PCR and further bred to C57BL/6J mice (Stock No. 000664) for 10 generations by the donating lab (see SNP note below). Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

In 2020, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the rederived living colony at The Jackson Laboratory Repository. Seven of the 43 markers were segregating with SJL, suggesting an incomplete backcross.

Allele

Symbol: Cacna2d4^em1Leea
Name: endonuclease-mediated mutation 1, Amy Lee
MGI accession ID: MGI:6200657
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Synonyms: alpha2delta-4 KO
Marker symbol: Cacna2d4
Marker name: calcium channel, voltage-dependent, alpha 2/delta subunit 4
Marker synonyms: 5730412N02Rik; RCD4; RGD1562038
Chromosome: 6
Strain of origin: C57BL/6J x (C57BL/6J x SJL/J)F1/J
Molecular note: Exon 2 was targeted using two sgRNAs and Cas9n (nickase version of Cas9). The result was an out-of-frame deletion (c.360_408del) that leads to a premature translation stop codon after 14 novel codons.