STOCK Krt6a^{em1(cre/ERT2)Tchn}/J

Stock number: 035093
Product name: Krt6-CreER
Research areas: Internal/Organ Research, Research Tools

Description

Krt6-CreERmice have a CRISPR/Cas9 generated insertion of an IRES-Cre/ERT2-SV40pA cassette inserted into the 3' UTR of the Krt6a gene, without disrupting endogenous gene expression. These mice may be used to generate tamoxifen-induced conditional mutations for studying gain-or-loss of function and/or fate mapping related to KRT6A expression during stem cell differentiation.

Detailed description

CRISPR/cas9 endonuclease mediated genome editing of the keratin 6A (Krt6a) gene was used to introduce an IRES-Cre/ERT2-SV40pA cassette into the 3’ UTR, in these Krt6-CreER mice. These mice have both endogenous gene and Cre recombinase expression directed to Krt6a-expressing cells by the endogenous promoter/enhancer elements of the Krt6a gene. The Krt6a gene encodes an epidermis-specific type I keratin involved in wound healing and epithelial migration. Restricted to the cytoplasm, cre-ERT2 can only gain access to the nuclear compartment after exposure to tamoxifen. When Krt6-CreER mice are bred with mice containing loxP-flanked sequences, tamoxifen-inducible Cre-mediated recombination will result in deletion of the floxed sequences in the Cre-expressing cells of the offspring. Heterozygous mice are viable and fertile, the donating investigator did not attempt to make a homozygous colony.

When bred with a strain expressing a floxed Notch pathway co-factor, Rbpj, deletion of RBP-J in Krt6-expressing hair follicle stem cells and their progenitor cells results in ectopic melanocyte stem cell differentiation due to an increase in retinoic acid upon tamoxifen injection.

Development

A plasmid encoding a guide RNA was designed to introduce an internal ribosome entry site (IRES) fused to a cre/ERT2 cassette, followed by an SV40 polyadenylation sequence, into the 3’ UTR (before the tgctcagagccccgagttcaggg sequence) of the keratin 6a (Krt6a) gene. Guide RNA and the cas9 nuclease were introduced into the cytoplasm of C57BL/6-derived fertilized eggs with well recognized pronuclei. Correctly targeted embryos were transferred to pseudopregnant females. Krt6-CreER pups were identified by PCR. These mice were further bred to C57BL/6 mice for at least 14 generations by the donating lab to develop the colony (see SNP note below). It is unknown if any potential off-target sites are present. This strain also contained a Rosa26 reporter allele from Ai14 mice (Stock No. 007914). Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J (Stock No. 000664) oocytes. The Ai14 allele was bred out of this colony.



A 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the rederived living colony at The Jackson Laboratory Repository. Most of the markers throughout the genome were segregating with an unknown source, suggesting an incomplete backcross.

Allele

Symbol: Krt6a^{em1(cre/ERT2)Tchn}
Name: endonuclease-mediated mutation 1, Ting Chen
MGI accession ID: MGI:6401425
Generation method: Endonuclease-mediated
Attributes: Recombinase-expressing; Inducible
Synonyms: Krt6-CreER
Marker symbol: Krt6a
Marker name: keratin 6A
Marker synonyms: CK6A; CK-6A; CK6B; CK-6B; CK6C; CK-6C; CK6D; CK-6E; K6A; K6B; K6C; K6D; K6E; Krt2-6a; Krt2-6c; KRT6C; KRT6D; KRT6E; KRTL1; mK6[a]; MK6a; PC2; PC3; PC4; PPKNEFD
Chromosome: 15
Strain of origin: Not Specified
Site of expression: hair follicle stem cells
Molecular note: CRISPR/Cas9 genome editing is used to insert an IRES-CreERT2-SV40poly cassette after exon 9.