C57BL/6J-Kcnq2^em8Lutzy/Mmjax

Stock number: 034974
Product name: Kcnq2^indel
Research areas: Developmental Biology Research, Neurobiology Research

Description

Kcnq2^indel is a CRISPR/Cas9 generated mutant of the potassium voltage-gated channel, subfamily Q, member 2 gene carrying a 1bp (A) insertion (indel mutation) in exon 4. These mice may be useful in studying epilepsy.

Detailed description

Kcnq2 (potassium voltage-gated channel, subfamily Q, member 2) encodes an integral membrane protein that associates with Kncq3 to form the M current, a potassium channel involved in the regulation of pyramidal neuron excitability and spike behavior. Mutations in Kcnq2 are associated with some types of epilepsy.

CRISPR/Cas9 endonuclease-mediated genome editing of Kcnq2 exon 4 created a 1 bp insertion (A) that results in a frameshift. If additional characterization of Kcnq2^indel mice is performed, we may modify the strain description accordingly. Heterozygous mice are viable and fertile. Homozygous mice are embryonic or perinatal lethal.

Development

The Kcnq2^em8Lutzy (Kcnq2^indel) allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing at The Jackson Laboratory. A guide RNA (GGTAGTCTACGCTCACAGCA) was selected to target exon 4 of the potassium voltage-gated channel, subfamily Q, member 2 locus on Chromosome 2. Donor DNAs were originally designed to introduce an H228R mutation. These sequences and Cas9 nuclease were introduced into C57BL/6J zygotes, and then transferred to pseudopregnant females. Progeny were screened by DNA sequencing of the targeted region and identified as harboring a 1 bp insertion (A) in the PAM site at aa 229. The mutation creates a frameshift mutation. This founder was bred to C57BL/6J (Stock No. 000664) for germline transmission. This strain does not carry the H228R mutation. The colony was backcrossed to C57BL/6J for a total of at least two generations.

Allele

Symbol: Kcnq2^em8Lutzy
Name: endonuclease-mediated mutation 8, Cathy Lutz
MGI accession ID: MGI:6883657
Generation method: Endonuclease-mediated
Attributes: Not Specified
Synonyms: Kcng2^indel
Marker symbol: Kcnq2
Marker name: potassium voltage-gated channel, subfamily Q, member 2
Marker synonyms: BFNC; DEE7; EBN; EBN1; ENB1; HNSPC; KCNA11; KQT2; KV7.2; Nmf134
Chromosome: 2
Strain of origin: C57BL/6J
Molecular note: CRISPR/cas9 genome editing uses a guide RNA (GGTAGTCTACGCTCACAGCA) to target exon 4. The resulting indel mutation was identified as a 1 bp insertion (A) in the PAM site at aa 229. The mutation creates a frameshift mutation.