B6(Cg)-Slc17a8^{em1(icre/ERT2)Zyliu}/J

Stock number: 034736
Product name: vGlut3-P2A-iCreER
Research areas: Neurobiology Research, Research Tools

Description

vGlut3-P2A-iCreERT2 mice carry a CRISPR/Cas9 generated insertion of a P2A-iCre/ERT2 cassette in exon 12, immediately before the stop codon of the Slc17a8 gene, without disrupting endogenous vesicular glutamate transporter 3 expression. These mice may be used to generate tamoxifen-induced conditional mutations for studying gain-or-loss of function and/or fate mapping related to glutamatergic synaptic vesicle trafficking.

Detailed description

CRISPR/cas9 endonuclease mediated genome editing of the solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8 (Slc17a8) gene was used to introduce a P2A-icre/ERT2 cassette into exon 12, immediately before the stop codon, in these vGlut3-P2A-iCreERT2 mice. The presence of the P2A peptide allows translation-coupled cleavage of the VGLUT3 protein and icre/ERT. As such, these mice have both endogenous gene and Cre recombinase expression directed to Vglut3-expressing cells by the endogenous promoter/enhancer elements of the Slc17a8 gene. The Slc17a8 gene encodes the vesicular glutamate transporter 3 (Vglut3) protein that mediates synaptic transmission by transporting the neurotransmitter, glutamate, into secretory vesicles. Normally expressed in inner hair cells (IHCs), loss of vGlut3 causes deafness. Restricted to the cytoplasm, cre-ERT2 can only gain access to the nuclear compartment after exposure to tamoxifen. When vGlut3-P2A-iCreERT2 mice are bred with mice containing loxP-flanked sequences, tamoxifen-inducible Cre-mediated recombination will result in deletion of the floxed sequences in the Cre-expressing cells of the offspring. Homozygous mice are viable and fertile.

When bred with Rosa26 reporter strain Ai9 (see Stock No. 007905 and Stock No. 007909), vGlut3-expressing cells can be permanently marked upon tamoxifen injection for postnatal lineage tracing. Approximately, 10.7%, 85.6% and 41.8% of cochlear inner hair cells (IHCs) are tdtomato⁺ when tamoxifen is given to vGlut3-P2A-iCreER/+; Rosa26-LSL-tdtomato/+ reporter strain at P2/P3, P10/P11 and P30/P31, respectively. In addition, inner ear glial cells also express vGlut3, and glia cells are also tdtomato⁺. The donating investigator lab also found that inner ear vestibular hair cells were also tdtomato⁺.

Of note, a similar strain carrying a constitutively active Cre recombinase under control of the endogenous Vglut3 promoter/enhancer elements is available as (Stock No. 028534).

Development

A plasmid encoding a guide RNA (CTGAGAAGTCTCCTTCGGCC), and PAM sequence TGG, was designed to introduce a P2A peptide fused to an icre/ERT2 cassette into exon 12, immediately before the stop codon, of the solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8 (Slc17a8) gene. The presence of the P2A peptide allows translation-coupled cleavage of the VGLUT3 protein and icre/ERT. Guide RNA and the cas9 nuclease were introduced into the cytoplasm of C57BL/6NCrl-derived fertilized eggs with well recognized pronuclei. Correctly targeted embryos were transferred to pseudopregnant females. vGlut3-P2A-iCreERT2 pups were identified by PCR. These vGlut3-P2A-iCreERT2 mice were further bred to C57BL/6NCrl mice for at least 10 generations to develop the colony. Southern-blot analysis showed that there were no random insertions of donor DNA in the genome. Upon arrival at The Jackson Laboratory, mice were found to contain Thy1^a from an unknown source. To establish our live colony, sperm was cryopreserved and an aliquot of frozen sperm was used to fertilize C57BL/6NJ (Stock No. 005304) oocytes. The Thy1^a present in these mice was bred out of this colony and replaced with the C57BL/6-like Thy1^b.

In 2020, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the rederived living colony at The Jackson Laboratory Repository. Four of the 5 markers that determine C57BL/6J from C57BL/6N were found to be segregating, including the rd8 recessive mutation associated with retinal degeneration on Chromosome 1 within the Crb1 locus. These data suggest the mice sent to The Jackson Laboratory Repository were on a mixed C57BL/6N;C57BL/6J genetic background.

Allele

Symbol: Slc17a8^{em1(icre/ERT2)Zyliu}
Name: endonuclease-mediated mutation 1, Zhiyong Liu
MGI accession ID: MGI:6384614
Generation method: Endonuclease-mediated
Attributes: Recombinase-expressing; Inducible
Synonyms: vGlut3-P2A-iCreER
Marker symbol: Slc17a8
Marker name: solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8
Marker synonyms: DFNA25; VGLUT3; Vgt3
Chromosome: 10
Strain of origin: C57BL/6N
Site of expression: Inner hair cells (IHCs).
Molecular note: A plasmid encoding a guide RNA and PAM sequence TGG was designed to introduce a P2A peptide fused to an icre/ERT2 cassette into exon 12, immediately before the stop codon, of the solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8 (Slc17a8) gene. Guide RNA and the cas9 nuclease were introduced into the cytoplasm of C57BL/6N-derived fertilized eggs with well recognized pronuclei.