C57BL/6-Tlr9^em1.1Ldm/J

Stock number: 034449
Product name: Tlr9 KO

Research areas: Immunology, Inflammation and Autoimmunity Research, Research Tools

Description

Tlr9 KO mutant mice lack exon 1 of the Tlr9 (toll like receptor 9) gene and may be useful for studying pathogen recognition and activation of innate immunity.

Detailed description

TLR9 (toll-like receptor 9) is a transmembrane receptor, mainly expressed in the endocytic compartment, which plays a fundamental role in recognizing DNA that contains unmethylated CpG dinucleotides, and subsequent activation of innate immunity. This gene has been implicated in the pathogenesis of several autoimmune diseases. These Tlr9 KO mice lack exon 1 of the Tlr9 gene. Mice that are heterozygous for the mutation are viable and fertile. Homozygous mice have not been characterized. These mice may be useful for studying pathogen recognition and activation of innate immunity.

Of note, the TLR9 conditional KO is available as (Stock No. 034448).

Development

CRISPR/Cas9 endonuclease-mediated genome editing was used to insert loxP sites flanking exon 1. A double guide RNA and Cas9 endonuclease mRNA were introduced into C57BL/6J-derived fertilized eggs by pronuclear injection along with a donor plasmid containing Tlr9 exon 1 flanked in the 3' and 5' intronic sequences with a loxP sequence (ATAACTTCGTATAATGTATGCTATACGAAGTTAT). Embryos were transferred to pseudopregnant females, and correctly targeted pups were bred to C57BL/6J mice for germline transmission. Sequencing of N1 mice revealed the correct insertion of 5' and 3' loxP sites in cis. Mice were then crossed to C57BL/6-Tg(Zp3-cre)93Knw/J (Stock No. 003651) to remove exon 1. Upon arrival, mice were bred to C57BL/6J (Stock No. 000664) for at least 1 generation to establish the colony.

Allele

Symbol: Tlr9^em1.1Ldm
Name: endonuclease-mediated mutation 1.1, Louis De Muynck
MGI accession ID: MGI:6385175
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Synonyms: Tlr9 KO
Marker symbol: Tlr9
Marker name: toll-like receptor 9
Marker synonyms: CD289
Chromosome: 9
Strain of origin: C57BL/6J
Molecular note: CRISPR/Cas9 endonuclease-mediated genome editing was used to insert loxP sites flanking exon 1. Cre-mediated recombination removed exon 1.