NOD/ShiLtJ-Cd8a^em1Doi/J

Stock number: 034311
Product name: CD8^tdTomato
Research areas: Neurobiology Research, Research Tools

Description

Cd8a^tdTomato mice have a CRISPR/Cas9-generated insertion of a red fluorescent protein (tdTomato) with an SV40 polyadenylation sequence inserted into exon 1, following the ATG codon and resulting in a 64 bp deletion, of the Cd8a gene. This strain is useful as a CD8⁺ T cell specific fluorescent reporter.

Detailed description

CRISPR/cas9 endonuclease mediated genome editing of the CD8 antigen, alpha chain (Cd8a) gene was used to insert a red fluorescent protein (tdTomato) with an SV40 polyadenylation sequence into exon 1. This insertion was directly downstream of the ATG codon and results in a 64 bp deletion in Cd8a. The targeted gene encodes a cell surface glycoprotein found on dendritic cells, intestinal intra-epithelial cells, and CD8 T cells. These mice specifically express tdTomato in CD8⁺ T cells. Homozygous mice are viable and fertile. The insertion of the itagBFP2 reporter construct did not significantly affect the incidence of diabetes as compared to wildtype NOD mice.

Development

Plasmids encoding a signal guide RNA (GCGGGTCAACGGTGAGGCCA) designed to introduce a red fluorescent protein (tdTomato) with an SV40 polyadenylation sequence inserted into exon 1, following the ATG codon, of the CD8 antigen, alpha chain (Cd8a) gene, and the cas9 nuclease were introduced into the cytoplasm of NOD-derived fertilized eggs with well recognized pronuclei. The insertion of tdTomato results in a 64 bp deletion in exon 1. Correctly targeted embryos were transferred to Swiss Webster pseudopregnant females. Correctly targeted pups were identified and further bred to NOD mice to develop the colony. These mice were bred to mice carrying a Flt3^itagBFP2 knock-in and a FoxP3-DTR/EGFP Tg both on an NOD background. Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize NOD/ShiLtJ (Stock No. 001976) oocytes. Subsequently, the Flt3^itagBFP2 knock-in allele and the FoxP3-DTR/EGFP Tg were bred out of the colony. The Flt3^itagBFP2 knock-in mice are available as Stock No. 034270, while the FoxP3-DTR/EGFP Tg mice are available as Stock No. 028763.

Allele

Symbol: Cd8a^em1Doi
Name: endonuclease-mediated mutation 1, Christophe Benoist and Diane Mathis
MGI accession ID: MGI:6386244
Generation method: Endonuclease-mediated
Attributes: Reporter; Epitope tag
Synonyms: CD8a^tdTomato
Marker symbol: Cd8a
Marker name: CD8 antigen, alpha chain
Marker synonyms: CD8; CD8alpha; IMD116; Leu2; Ly-2; Ly-35; Ly-B; Lyt-2; p32
Chromosome: 6
Strain of origin: NOD
Site of expression: CD8+ T cells
Molecular note: CRISPR/Cas9 genome editing is used to introduce a red fluorescent protein (tdTomato) with a 5' HA tag, an SV40 polyadenylation sequence and 3' HA tag into exon 1, following the ATG codon. The insertion of tdTomato results in a 64 bp deletion in exon 1.