B6;129S4-Npnt^{em1(flpo)Ngai}/TasicJ

Stock number: 034305
Product name: Npnt-P2A-FlpO
Research areas: Cell Biology Research, Developmental Biology Research, Neurobiology Research, Research Tools

Description

Npnt-P2A-FlpO knock-in mice are designed to have optimized FLP recombinase expression directed to nephronectin-expressing cells. These mice may be used to generate conditional mutations for studying the function of this extracellular matrix protein.

Detailed description

Nephronectin (encoded by Npnt) is an extracellular matrix protein expressed in kidney, lung, brain, uterus, placenta, thyroid, blood vessels and in several tissues during embryonic development.

The Npnt-P2A-FlpO knock-in mutation has an P2A sequence and an optimized FLP recombinase (FlpO) gene replacing the Npnt STOP codon - this is designed to have the endogenous promoter/enhancer elements direct FlpO expression to NPNT+ cells. When Npnt-P2A-FlpO mice are bred with mice containing frt-flanked sequences, FlpO-mediated recombination will result in deletion of the frt-flanked sequences in Npnt-expressing cells in the offspring.

The donating investigator reports FlpO recombinase expression/activity in cortical layer 5 pyramidal tract neurons. The donating investigator did not examine FlpO expression in tissues other than brain.

This knock-in allele is designed to avoid disrupting expression of the endogenous protein; although Npnt expression from the Npnt-P2A-FlpO allele has not been evaluated to date (February 2020).

Heterozygous mice are viable and fertile with no reported gross physical or behavioral abnormalities. It has not been attempted to make this strain homozygous to date (February 2020).

Development

The Npnt-P2A-FlpO allele was generated using CRISPR/Cas9 endonuclease-mediated homology-directed repair (HDR) genome editing by the laboratory of Dr. John Ngai (University of California, Berkeley). The specific details are below.
First, a ribonucleoprotein complex (cas9-RNP) was created consisting of the CRISPR/Cas9 nuclease fused to a guide RNA sequence [GATGATGTGAGCTTGAAAAG] designed to target the STOP codon of the nephronectin gene (Npnt) on chromosome 3. A lacZ sequence was also later identified (see below). The cas9-RNP complex and a P2A-FlpO ssDNA (encoding a viral 2A oligopeptide that mediates ribosomal skipping and a codon-optimized FLPe gene modified for translation in mammalian cells and higher recombination efficiency in cells and in mice) with Npnt homology arms were injected into (C57BL/6 x 129S4/SvJae)F1-derived v6.5 embryonic stem (ES) cells. Chimeric mice were generated by aggregating ES cells with morula-stage embryos, and chimeras were reported to have been bred to C57BL/6 mice to achieve germline transmission. The donating investigator reports the resulting Npnt-P2A-FlpO colony was bred with C57BL/6 for at least one generation. In 2020, Dr. Hongkui Zeng (Allen Institute for Brain Science) sent males from generation N1 (black coat color) to The Jackson Laboratory. Upon arrival, these males were used to cryopreserve sperm (see SNP note below).
Of note, it is not known if the Y chromosome has been fixed to the C57BL/6J background during backcrossing.

In 2020, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the two males sent to The Jackson Laboratory Repository. Most of the markers were C57BL/6J allele-type and some were C57BL/6;129 (as expected). Importantly, one of the markers that determine C57BL/6J from C57BL/6N was found to be segregating in both males: the rd8 recessive mutation associated with retinal degeneration on Chromosome 1 within the Crb1 locus. These data suggest the mice sent to The Jackson Laboratory Repository (and used to freeze sperm) were on a mixed C57BL/6;129 genetic background (as expected) with a possible C57BL/6N contribution including the Crb1^rd8 mutation.

In 2020, genotyping at The Jackson Laboratory determined this allele also contains some lacZ sequences (undetermined if its the entire lacZ coding sequence or a smaller portion).

Allele

Symbol: Npnt^{em1(flpo)Ngai}
Name: endonuclease-mediated mutation 1, John Ngai
MGI accession ID: MGI:6865658
Generation method: Endonuclease-mediated
Attributes: Recombinase-expressing
Marker symbol: Npnt
Marker name: nephronectin
Marker synonyms: 1110009H02Rik; EGFL6L; POEM
Chromosome: 3
Strain of origin: (C57BL/6 x 129S4/SvJae)F1
Molecular note: Using CRISPR/Cas9 technology, the P2A-FlpO sequence (encoding a viral 2A oligopeptide that mediates ribosomal skipping and a codon-optimized FLPe gene modified for translation in mammalian cells and higher recombination efficiency in cells and in mice) was inserted after the STOP codon of the nephronectin gene (Npnt) on chromosome 3 in v6.5 embryonic stem (ES) cells. Chimeric mice were generated by aggregating ES cells with morula-stage embryos.