C57BL/6J-Rbpj^em4Lutzy/J

Stock number: 034202
Product name: Rbpj^indel KO , Rbpj del553
Research areas: Cardiovascular Research, Cell Biology Research, Developmental Biology Research, Immunology, Inflammation and Autoimmunity Research, Neurobiology Research, Research Tools

Description

Rbpj^indel KO mice carry a CRISPR/Cas9-generated knock-out deletion of exon 4 of the mouse Rbpj (recombination signal binding protein for immunoglobulin kappa J region) gene. Deletion of exon 4 is predicted to cause a change of amino acid sequence after residue 91 and an early truncation 22 amino acids later.

Detailed description

Rbpj^indel KO mice carry a CRISPR/Cas9-generated knock-out deletion of exon 4 of the mouse Rbpj (recombination signal binding protein for immunoglobulin kappa J region) gene. Deletion of exon 4 is predicted to cause a change of amino acid sequence after residue 91 and an early truncation 22 amino acids later. Heterozygotes are viable and fertile. Homozygotes are not viable.

Development

The Rbpj^indel KO allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing based on ENSEMBL Transcript ID ENSMUST00000037618.12 at The Jackson Laboratory.

Guide RNAs were selected to target upstream (ACTTATACCATCAGTTAGAT; AGCAGGACCAATCTAACTGA) and downstream (CTGCTGGCTCATAGTGTGCG; CCCGCACACTATGAGCCAGC) regions of exon 4 of the Rbpj (recombination signal binding protein for immunoglobulin kappa J region) gene on mouse Chromosome 5. Though designed to create a floxed conditional line (see Stock No. 034200), they instead created a 553 bp deletion incorporating exon 4 (TCTGCTTAAAGCAGGACCAATCT/del553/GCGGGGTAGCATTTAAAGGCAGCAC). The mutation was created in C57BL/6J embryos. The strain was backcrossed to C57BL/6J mice (Stock No. 000664) for at least 2 generations. This is founder line 3895.

Allele

Symbol: Rbpj^em4Lutzy
Name: endonuclease-mediated mutation 4, Cathy Lutz
MGI accession ID: MGI:6870526
Generation method: Endonuclease-mediated
Attributes: Not Specified
Synonyms: Rbpj^indel
Marker symbol: Rbpj
Marker name: recombination signal binding protein for immunoglobulin kappa J region
Marker synonyms: AOS3; CBF1; CBF-1; csl; IGKJRB; IGKJRB1; Igkrsbp; KBF2; RBP-J; RBP-J kappa; RBPjk; RBP-JK; RBPSUH; SUH
Chromosome: 5
Strain of origin: C57BL/6J
Molecular note: CRISPR/cas9 genome editing using guide RNAs in the upstream (ACTTATACCATCAGTTAGAT; AGCAGGACCAATCTAACTGA) and downstream (CTGCTGGCTCATAGTGTGCG; CCCGCACACTATGAGCCAGC) regions of exon 4 originally designed to create a floxed conditional line instead created a 553 bp deletion incorporating exon 4 (TCTGCTTAAAGCAGGACCAATCT/del553/GCGGGGTAGCATTTAAAGGCAGCAC).