NOD/ShiLtJ-Scn9a^em1Jnsn/J

Stock number: 034187
Product name: Nod.Scn9a-flox
Research areas: Neurobiology Research, Research Tools, Sensorineural Research

Description

Nod.Scn9a-flox mutant mice possess loxP sites flanking exon 3 of the Scn9a (sodium channel, voltage-gated, type IX, alpha) gene and may be useful in generating conditional mutations to study nociception in Type 1 diabetes.

Detailed description

Scn9a (sodium channel, voltage-gated, type IX, alpha) encodes the Nav1.7 isoform, and plays an important role in pain and nociception. Mutations in SCN9A have been associated with different "channelopathies" with electrical hyperactivity of sensory neurons in dorsal root and a low reactivity of sympathetic ganglia neurons. These conditional Nod.Scn9a-flox mice possess loxP sites flanking exon 3 of the Scn9a gene. Mice that are homozygous for the mutation are viable and fertile. When bred to mice that express tissue-specific Cre recombinase, resulting offspring will have the exon 3 deleted in cre-expressing tissues. These mice may be useful for studying nociception in Type 1 diabetes.

Development

CRISPR/Cas9 endonuclease-mediated genome editing was used to insert loxP sites flanking exon 3. A single guide RNA with a spacer sequence and Cas9 endonuclease mRNA were introduced into NOD/ShiLtJ-derived fertilized eggs by pronuclear injection along with a single-strand oligonucleotide repair template with the loxP sequence (ATAACTTCGTATAATGTATGCTATACGAAGTTAT). Embryos were transferred to pseudopregnant females, and correctly targeted pups were bred to wildtype mice for germline transmission. Sequencing of N1 mice revealed the correct insertion of 5' and 3' loxP sites in cis. The colony was maintained in the NOD/ShiLtJ background (Stock No. 001976).

Allele

Symbol: Scn9a^em1Jnsn
Name: endonuclease-mediated mutation 1, James Johnson
MGI accession ID: MGI:6358177
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed)
Synonyms: Scn9a-flox
Marker symbol: Scn9a
Marker name: sodium channel, voltage-gated, type IX, alpha
Marker synonyms: ETHA; FEB3B; GEFSP7; HSAN2D; Nav1.7; NENA; NE-NA; PN1; Scn2a; SFNP
Chromosome: 2
Strain of origin: NOD/ShiLtJ
Molecular note: CRISPR/Cas9 endonuclease-mediated genome editing is used to insert loxP sites flanking exon 3. A single guide RNA with a spacer sequence and Cas9 endonuclease mRNA were introduced into NOD/ShiLtJ-derived fertilized eggs by pronuclear injection along with a single-strand oligonucleotide repair template with the loxP sequence (ATAACTTCGTATAATGTATGCTATACGAAGTTAT).