B6.Cg-Igs7^{tm175(tetO-EGFP/RNAi:Pou5f1,CAG-tdTomato,-tTA2)Tasic}/J

Stock number: 034103
Product name: Ai175 [or Ai175(TIT2L-EGFP-shOct4-ICL-tdT-tTA2]
Research areas: Cell Biology Research, Neurobiology Research, Research Tools

Description

Ai175 (also called Ai175(TIT2L-EGFP-shOct4-ICL-tdT-tTA2)) is a Cre-dependent, Tet-controllable transcription tool strain with dual fluorescent reporters, created by targeted insertion at the Igs7 locus (TIGRE). Exposure to Cre recombinase removes both STOP cassettes, resulting in tTA2 expression, robust tdTomato fluorescence and EGFP/shOct4 fusion protein expression (robust EGFP fluorescence and potential knockdown of endogenous Pou5f1 expression by short hairpin RNA shOct4). The EGFP/shOct4 expression may be expected to be diminished/eliminated by doxycycline.

Detailed description

Ai175 mice harbor the TIGRE-Ins-TRE2-LSL-EGFP-shOct4-Ins-CAG-LSL-tdT-P2A-tTA2 conditional allele, designed with a TRE2 promoter, loxP-STOP-loxP cassette and an EGFP fused to shOct4 (a short hairpin RNA that targets/silences Pou5f1), and then a CAG promoter, lox2272-STOP-lox2272 cassette and bicistronic tdTomato-P2A-tTA2 sequence. Prior to Cre recombinase exposure, this allele is designed to have the two floxed-STOP cassettes preventing expression of the downstream genes (EGFP/shOct4, tdTomato and tTA2). When bred to mice expressing Cre recombinase, the resulting offspring will have both floxed-STOP cassettes deleted in the Cre-expressing cells/tissues - resulting in tTA2 expression, robust tdTomato fluorescence and EGFP/shOct4 fusion protein expression (robust EGFP fluorescence and potential knockdown of endogenous Pou5f1). Due to its placement downstream of the TRE2 promoter, subsequent introduction of tetracycline (or its analog doxycycline [dox]) is expected to diminish/eliminate EGFP/shOct4 expression.

The donating investigator reports in the absence of Cre, mice heterozygous for Ai175 are viable and fertile with no reported gross physical or behavioral abnormalities. It has not been attempted to make this strain homozygous to date (April 2021). They observe very weak native GFP fluorescence in hippocampus and scattered throughout cortex, but this is very low compared to the levels observed following exposure to Cre recombinase.

When Ai175 mice are bred with Cre-driver lines to create double mutant animals (EGFP/shOct4+tdT+tTA2+/Cre+), cells expressing both tTA2 and Cre exhibit robust/bright fluorescence (both EGFP and tdTomato). While shOct4 is predicted to substantially knock-down Pou5f1 expression, the donating laboratory has not yet specifically characterized that in vivo (April 2021).

Several Cre-driver lines with specific expression patterns have been used with Ai175 - resulting in double mutant offspring with no viability problems and robust/bright EGFP and tdTomato expression (including Nr5a1-Cre and Ntsr1-Cre).
In addition, they do not recommend crossing Ai175 to pan-excitatory or pan-inhibitory driver lines because the resulting double mutant Cre expression during early embryonic development leads to high tTA2 expression levels, which promotes neurodegeneration and cytotoxicity (as shown for their other similarly designed reporters in Daigle et al. 2018 Cell 174:465 [PMID:30007418]).

The dox-inducible attenuation of EGFP/shOct4 expression has not been characterized to date (April 2021). However, they expect that dox-inducible attenuation of EGFP/shOct4 expression would be variable dependent on which Cre-driver line is utilized - similar to that observed for Ai139 mice (Stock No. 034099).

To date (April 2021), the donating investigator has not evaluated Cre-inducible Ai175 expression in tissues other than brain.

Development

The Ai175 allele (or Ai175(TIT2L-EGFP-shOct4-ICL-tdT-tTA2)) has a Tet response element TRE2, loxP-STOP-loxP cassette, EGFP/shOct4 fusion sequence that is followed by a CAG promoter, lox2272-STOP-lox2272 cassette and tTA2 sequence - all inserted into the T1 TIGRE locus (an intergenic region on chromosome 9 [between AB124611 and Carm1] determined to have low basal transcriptional activity and allow high Cre and/or Tet inducibility).

Specifically, the pTRE2-LSL-EGFP-shOct4-CAG-LSL-tdT-P2A-tTA2 replacement vector was designed with (from 5' to 3') an FRT3 site, two copies of chicken beta-globin HS4 insulator element (to reduce reporter gene expression in absence of transactivators), a Tet response element/promoter (TRE2; details below), a loxP-flanked STOP cassette (stop codons in all three reading frames linked to synthetic pA-hGHpA-PGKpA), an EGFP/shOct4 fusion protein (described below), a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE; to enhance the mRNA transcript stability), a BGH polyA, two copies of chicken beta-globin HS4 insulator element, a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG; from pCAGGS), a lox2272-flanked STOP cassette (stop codons in all three reading frames linked to synthetic pA-hGHpA-TKpA), a tdTomato sequence (tdT; encoding the non-oligomerizing DsRed fluorescent protein variant with a 12 residue linker fusing two copies of the protein [tandem dimer]), a viral 2A oligopeptide that mediates ribosomal skipping (P2A; from porcine teschovirus-1), a synthetic modified tetracycline-regulated transactivator gene (tTA2^S), a WPRE, a BGH polyA, an AttB site, a PGK-5'hygro cassette, an RNA splice donor and a FRT5 site.
(129S6/SvEvTac x C57BL/6)F1-derived G4 embryonic stem cells previously targeted with FRT3::AttB::PGK-neoR-polyA::FRT5::splice acceptor::3'hygro cassette::SV40pA::AttP in TIGRE, were re-transfected with the pTRE2-LSL-EGFP-shOct4-CAG-LSL-tdT-P2A-tTA2 replacement vector and Flp recombinase vector for recombinase-mediated cassette exchange (RCME). Chimeric mice were bred with C57BL/6J mice. The Ai175 allele is therefore TIGRE-frt3-Ins-TRE2-LSL-EGFP-shOct4-WPRE-bGHpA-Ins-CAG-LSL-tdT-P2A-tTA2-WPRE-bGHpA-AttB-PGK-5'hygro-SD-frt5-SA-3'hygro-SV40pA-AttP. The resulting Ai175 mice were bred with C57BL/6J for several generations. In 2020, males from generation N9 (black coat color) were sent to The Jackson Laboratory. Upon arrival, males are used to cryopreserve sperm. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. 000664).
The donating investigator reports that, at least once during backcrossing, a heterozygous female was bred to a C57BL/6J inbred male (thus the Y chromosome of the congenic strain is of C57BL/6J origin).

The EGFP/shOct4 fusion protein is composed of a synthetic enhanced green fluorescent protein sequence (EGFP), a ~140bp linker sequence and a 121bp short hairpin RNA sequence (gaaggtatattgctgttgacagtgagcgacagaaggagctag aacagttttagtgaagccacagatgtaaaactgttctagctccttctgctgcctactgcctcggacttcaaggggctag) designed to target/silence the mouse octamer-binding transcription factor 4 encoding locus (Pou5f1; Oct4).

The TRE2 promoter used here is Tet-responsive P_hCMV*-1; containing the Tet response element (seven copies of the 19 bp tet operator sequence [tetO]) just upstream of a minimal cytomegalovirus promoter (P_{min CMV}), which lacks the enhancer that is part of the complete CMV promoter. Consequently, P_hCMV*-1 is silent in the absence of tTA or rtTA binding to tetO.

Allele

Symbol: Igs7^{tm175(tetO-EGFP/RNAi:Pou5f1,CAG-tdTomato,-tTA2)Tasic}
Name: targeted mutation 175, Bosiljka Tasic
MGI accession ID: MGI:6514371
Generation method: Targeted
Attributes: Conditional ready (e.g. floxed); Reporter; Inducible; Transactivator
Synonyms: Ai175; Igs7^{tm175(tetO-EGFP/RNAi:Pou5f1,CAG-tdTomato,-tTA2)Hze}
Marker symbol: Igs7
Marker name: intergenic site 7
Marker synonyms: Iis7; TIGRE
Chromosome: 9
Strain of origin: (129S6/SvEvTac x C57BL/6NCrl)F1
Molecular note: The vector is designed with (from 5' to 3') an FRT3 site, two copies of chicken beta-globin HS4 insulator element (to reduce reporter gene expression in absence of transactivators), a Tet response element/promoter (TRE2; details below), a loxP-flanked STOP cassette (stop codons in all three reading frames linked to synthetic pA-hGHpA-PGKpA), an EGFP/RNAi:Pou5f1 fusion protein (described below), a woodchuck hepatitis virus post-transcriptional regulatory element, a BGH polyA, two copies of chicken beta-globin HS4 insulator element, a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter, a lox2272-flanked STOP cassette (stop codons in all three reading frames linked to synthetic pA-hGHpA-TKpA), a tdTomato sequence, a viral 2A oligopeptide), a synthetic modified tetracycline-regulated transactivator gene (tTA2(S)), a WPRE, a BGH polyA, an AttB site, a PGK-5'hygro cassette, an RNA splice donor, a FRT5 site, SA, 3'hygro, SV40pA, and AttP. The TRE2 promoter used here is Tet-responsive P>hCMV*-1<; containing the Tet response element (seven copies of the 19 bp tet operator sequence [tetO]) just upstream of a minimal cytomegalovirus promoter (P>min CMV<), which lacks the enhancer that is part of the complete CMV promoter. Consequently, P>hCMV*-1< is silent in the absence of tTA or rtTA binding to tetO. The EGFP/RNAi:Pouf5f1 fusion protein is composed of a synthetic enhanced green fluorescent protein sequence (EGFP), an ~140bp linker sequence and a 121bp short hairpin RNA sequence (gaaggtatattgctgttgacagtgagcgacagaaggagctag aacagttttagtgaagccacagatgtaaaactgttctagctccttctgctgcctactgcctcggacttcaaggggctag) designed to target/silence the mouse octamer-binding transcription factor 4 encoding locus (Pou5f1).