B6.Cg-Igs7^{tm174(tetO-EGFP/RNAi:Hdac1,CAG-tdTomato,-tTA2)Tasic}/J

Stock number: 034102
Product name: Ai174 [or Ai174(TIT2L-EGFP-shHDAC1-ICL-tdT-tTA2)]
Research areas: Cell Biology Research, Neurobiology Research, Research Tools

Description

Ai174 (also called Ai174(TIT2L-EGFP-shHDAC1-ICL-tdT-tTA2)) is a Cre-dependent, Tet-controllable histone deacetylation tool strain with dual fluorescent reporters, created by targeted insertion at the Igs7 locus (TIGRE). Exposure to Cre recombinase removes both STOP cassettes, resulting in tTA2 expression, robust tdTomato fluorescence and EGFP/shHDAC1 fusion protein expression (robust EGFP fluorescence and potential knockdown of endogenous histone deacetylase 1 expression by short hairpin RNA shHDAC1). The EGFP/shHDAC1 expression may be expected to be diminished/eliminated by doxycycline.

Detailed description

Ai174 mice harbor the TIGRE-Ins-TRE2-LSL-EGFP-shHDAC1-Ins-CAG-LSL-tdT-P2A-tTA2 conditional allele, designed with a TRE2 promoter, loxP-STOP-loxP cassette and an EGFP fused to shHDAC1 (a short hairpin RNA that targets/silences histone deacetylase 1), and then a CAG promoter, lox2272-STOP-lox2272 cassette and bicistronic tdTomato-P2A-tTA2 sequence. Prior to Cre recombinase exposure, this allele is designed to have the two floxed-STOP cassettes preventing expression of the downstream genes (EGFP/shHDAC1, tdTomato and tTA2). When bred to mice expressing Cre recombinase, the resulting offspring will have both floxed-STOP cassettes deleted in the Cre-expressing cells/tissues - resulting in tTA2 expression, robust tdTomato fluorescence and EGFP/shHDAC1 fusion protein expression (robust EGFP fluorescence and potential knockdown of endogenous HDAC1). Due to its placement downstream of the TRE2 promoter, subsequent introduction of tetracycline (or its analog doxycycline [dox]) is expected to diminish/eliminate EGFP/shHDAC1 expression.

The donating investigator reports in the absence of Cre, mice heterozygous for Ai174 are viable and fertile with no reported gross physical or behavioral abnormalities. It has not been attempted to make this strain homozygous to date (April 2021). They observe very weak native GFP fluorescence in hippocampus and scattered throughout cortex, but this is very low compared to the levels observed following exposure to Cre recombinase.

When Ai174 mice are bred with Cre-driver lines to create double mutant animals (EGFP/shHDAC1+tdT+tTA2+/Cre+), cells expressing both tTA2 and Cre exhibit robust/bright fluorescence (both EGFP and tdTomato). While shHDAC1 is predicted to substantially knock-down HDAC1 expression, the donating laboratory has not yet specifically characterized that in vivo (April 2021).

Several Cre-driver lines with specific expression patterns have been used with Ai174 - resulting in double mutant offspring with no viability problems and robust/bright EGFP and tdTomato expression (including Nr5a1-Cre and Ntsr1-Cre).
In addition, they do not recommend crossing Ai174 to pan-excitatory or pan-inhibitory driver lines because the resulting double mutant Cre expression during early embryonic development leads to high tTA2 expression levels, which promotes neurodegeneration and cytotoxicity (as shown for their other similarly designed reporters in Daigle et al. 2018 Cell 174:465 [PMID:30007418]).

The dox-inducible attenuation of EGFP/shHDAC1 expression has not been characterized to date (April 2021). However, they expect that dox-inducible attenuation of EGFP/shHDAC1 expression would be variable dependent on which Cre-driver line is utilized - similar to that observed for Ai139 mice (Stock No. 034099).

To date (April 2021), the donating investigator has not evaluated Cre-inducible Ai174 expression in tissues other than brain.

Development

The Ai174 allele (or Ai174(TIT2L-EGFP-shHDAC1-ICL-tdT-tTA2)) has a Tet response element TRE2, loxP-STOP-loxP cassette and EGFP/shHDAC1 fusion sequence that is followed by a CAG promoter, lox2272-STOP-lox2272 cassette and tTA2 sequence - all inserted into the T1 TIGRE locus (an intergenic region on chromosome 9 [between AB124611 and Carm1] determined to have low basal transcriptional activity and allow high Cre and/or Tet inducibility).

Specifically, the pTRE2-LSL-EGFP-shHDAC1-CAG-LSL-tdT-P2A-tTA2 replacement vector was designed with (from 5' to 3') an FRT3 site, two copies of chicken beta-globin HS4 insulator element (to reduce reporter gene expression in absence of transactivators), a Tet response element/promoter (TRE2; details below), a loxP-flanked STOP cassette (stop codons in all three reading frames linked to synthetic pA-hGHpA-PGKpA), an EGFP/shHDAC1 fusion protein (described below), a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE; to enhance the mRNA transcript stability), a BGH polyA, two copies of chicken beta-globin HS4 insulator element, a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG; from pCAGGS), a lox2272-flanked STOP cassette (stop codons in all three reading frames linked to synthetic pA-hGHpA-TKpA), a tdTomato sequence (tdT; encoding the non-oligomerizing DsRed fluorescent protein variant with a 12 residue linker fusing two copies of the protein [tandem dimer]), a viral 2A oligopeptide that mediates ribosomal skipping (P2A; from porcine teschovirus-1), a synthetic modified tetracycline-regulated transactivator gene (tTA2^S), a WPRE, a BGH polyA, an AttB site, a PGK-5'hygro cassette, -an RNA splice donor and a FRT5 site.
(129S6/SvEvTac x C57BL/6)F1-derived G4 embryonic stem cells previously targeted with FRT3::AttB::PGK-neoR-polyA::FRT5::splice acceptor::3'hygro cassette::SV40pA::AttP in TIGRE, were re-transfected with the pTRE2-LSL-EGFP-shHDAC1-CAG-LSL-tdT-P2A-tTA2 replacement vector and Flp recombinase vector for recombinase-mediated cassette exchange (RCME). Chimeric mice were bred with C57BL/6J mice. The Ai174 allele is therefore TIGRE-frt3-Ins-TRE2-LSL-EGFP-shHDAC1-WPRE-bGHpA-Ins-CAG-LSL-tdT-P2A-tTA2-WPRE-bGHpA-AttB-PGK-5'hygro-SD-frt5-SA-3'hygro-SV40pA-AttP. The resulting Ai174 mice were bred with C57BL/6J for several generations. In 2020, males from generation N6 (black coat color) were sent to The Jackson Laboratory. Upon arrival, males are used to cryopreserve sperm. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. 000664).
The donating investigator reports that, at least once during backcrossing, a heterozygous female was bred to a C57BL/6J inbred male (thus the Y chromosome of the congenic strain is of C57BL/6J origin).

The EGFP/shHDAC1 fusion protein is composed of a synthetic enhanced green fluorescent protein sequence (EGFP), a ~150bp linker sequence and a 97bp short hairpin RNA sequence (tgctgttgacagtgagcgagcttgggtaatagcagccatttagtgaagccacagatgtaaatggctgctattacccaagcctgcctactgcctcgga) designed to target/silence the mouse histone deacetylase 1 locus (Hdac1).

The TRE2 promoter used here is Tet-responsive P_hCMV*-1; containing the Tet response element (seven copies of the 19 bp tet operator sequence [tetO]) just upstream of a minimal cytomegalovirus promoter (P_{min CMV}), which lacks the enhancer that is part of the complete CMV promoter. Consequently, P_hCMV*-1 is silent in the absence of tTA or rtTA binding to tetO.

Allele

Symbol: Igs7^{tm174(tetO-EGFP/RNAi:Hdac1,CAG-tdTomato,-tTA2)Tasic}
Name: targeted mutation 174, Bosiljka Tasic
MGI accession ID: MGI:6514369
Generation method: Targeted
Attributes: Conditional ready (e.g. floxed); Reporter; Inducible; Transactivator
Synonyms: Ai174; Igs7^{tm174(tetO-EGFP/RNAi:Hdac1,CAG-tdTomato,-tTA2)Hze}
Marker symbol: Igs7
Marker name: intergenic site 7
Marker synonyms: Iis7; TIGRE
Chromosome: 9
Strain of origin: (129S6/SvEvTac x C57BL/6NCrl)F1
Molecular note: The vector is designed with (from 5' to 3') an FRT3 site, two copies of chicken beta-globin HS4 insulator element (to reduce reporter gene expression in absence of transactivators), a Tet response element/promoter (TRE2; details below), a loxP-flanked STOP cassette (stop codons in all three reading frames linked to synthetic pA-hGHpA-PGKpA), an EGFP/RNAi:Hdac1 fusion protein (described below), a woodchuck hepatitis virus post-transcriptional regulatory element, a BGH polyA, two copies of chicken beta-globin HS4 insulator element, a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter, a lox2272-flanked STOP cassette (stop codons in all three reading frames linked to synthetic pA-hGHpA-TKpA), a tdTomato sequence, a viral 2A oligopeptide), a synthetic modified tetracycline-regulated transactivator gene (tTA2(S)), a WPRE, a BGH polyA, an AttB site, a PGK-5'hygro cassette, an RNA splice donor, a FRT5 site, SA, 3'hygro, SV40pA, and AttP. The TRE2 promoter used here is Tet-responsive P>hCMV*-1<; containing the Tet response element (seven copies of the 19 bp tet operator sequence [tetO]) just upstream of a minimal cytomegalovirus promoter (P>min CMV<), which lacks the enhancer that is part of the complete CMV promoter. Consequently, P>hCMV*-1< is silent in the absence of tTA or rtTA binding to tetO. The EGFP/RNAi:HDAC1 fusion protein is composed of a synthetic enhanced green fluorescent protein sequence (EGFP), an ~150bp linker sequence and a 97bp short hairpin RNA sequence (tgctgttgacagtgagcgagcttgggtaatagcagccatttagtgaagccacagatgtaaatggctgctattacccaagcctgcctactgcctcgga) designed to target/silence the mouse histone deacetylase 1 locus (Hdac1).