B6(SJL)-Trem2^em1Aduci/J

Stock number: 034036
Product name: Trem2*R47H^NSS
Research areas: Mouse/Human Gene Homologs, Neurobiology Research

Description

Trem2*R47H^NSS is a CRISPR/Cas9-generated mutant of the triggering receptor expressed on myeloid cells 2 (Trem2) gene carrying the R47H mutation that corresponds to the human R47H mutation associated with late-onset Alzheimer's Disease (AD). These mice may be useful in pre-clinical studies of AD.

Detailed description

TREM2 is a cell surface receptor whose extracellular domain has a single immunoglobulin superfamily domain that binds polyanionic ligands including phospholipids and bacterial lipopolysaccharide (LPS). TREM2 conveys signals via DAP12 (aka TYROBP) that activate macrophages and dendritic cells during immune responses. The Trem2*R47H^NSS mutation is one of the strongest genetic risk factors for late-onset Alzheimer's disease.

To create the Trem2*R47H^NSS allele, CRISPR/Cas9 endonuclease-mediated genome editing of Trem2 was used to introduce a R47H mutation. R47H is homologous to the human R47H SNP shown to correlate with increased risk of late-onset Alzheimer's disease. If additional characterization of these Trem2*R47H^NSS mice is performed, we may modify the strain description accordingly.

RNA-seq analysis of hippocampus and cortex indicates that the Trem2^em1Aduci allele is expressed at a level similar to the wild-type Trem2 allele, with no evidence of cryptic splicing products from the mutant allele.

Both heterozygous and homozygous mice are viable and fertile.

Development

Guide RNAs (gaagcactgggggagacgca and gtacatgacaccctcaagga) were designed to create a guanine to adenine missense mutation, resulting in an arginine to histidine change at amino acid 47 (R47H) of the triggering receptor expressed on myeloid cells 2 (Trem2) gene. This mutation R47H is homologous to the human R47H SNP shown to correlate with increased risk of late-onset Alzheimer's disease. Ten silent DNA mutations were also introduced. The crRNA, tracrRNA and CAS9 nuclease were complexed to form a RNP, then introduced into the cytoplasm of C57BL/6J-derived zygotes with well recognized pronuclei. Surviving embryos were transferred to pseudopregnant females. Progeny were screened by DNA sequencing to identify correctly targeted Trem2*R47H^NSS pups, which were then bred to C57BL/6J mice (Stock No. 000664) for germline transmission. The Trem2*R47H^NSS colony was backcrossed to C57BL/6J for a total of at least two generations. At some point during development these mice were also bred to 5xFAD Tg mice (Stock No. 008730). The 5xFAD Tg was bred out of the mice that were shipped to The Jackson Laboratory. Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

Allele

Symbol: Trem2^em1Aduci
Name: endonuclease-mediated mutation 1, Frank LaFerla
MGI accession ID: MGI:6470973
Generation method: Endonuclease-mediated
Attributes: Humanized sequence
Synonyms: Trem2*R47H^NSS; Trem2^R47H
Marker symbol: Trem2
Marker name: triggering receptor expressed on myeloid cells 2
Marker synonyms: PLOSL2; TREM-2; Trem2a; Trem2b; Trem2c; Trem2-Mia; Trem2-Mib
Chromosome: 17
Strain of origin: C57BL/6J
Molecular note: Guide RNAs (gaagcactgggggagacgca and gtacatgacaccctcaagga) are designed to create a guanine to adenine missense mutation, resulting in an arginine to histidine change at amino acid 47 (R47H). This mutation R47H is homologous to the human R47H SNP shown to correlate with increased risk of late-onset Alzheimer's disease. Ten silent DNA mutations were also introduced.