B6(SJL)-Trem2^em1Aduci/J

Stock number: 034036
Product name: Trem2^{R47H NSS}
Research areas: Mouse/Human Gene Homologs, Neurobiology Research

Description

Trem2^{R47H NSS} is a CRISPR/Cas9-generated missense variant of the triggering receptor expressed on myeloid cells 2 (Trem2) gene carrying the R47H mutation that corresponds to the human R47H variant associated with late-onset Alzheimer's Disease (AD). These mice may be used to investigate age-dependent effects of the AD-risk R47H variant on TREM2 and microglial function including its effects on plaque development, microglial-plaque interaction, production of a unique interferon signature and associated tissue damage.

Detailed description

TREM2 is a cell surface receptor whose extracellular domain has a single immunoglobulin superfamily domain that binds polyanionic ligands including phospholipids and bacterial lipopolysaccharide (LPS). TREM2 conveys signals via DAP12 (aka TYROBP) that activate macrophages and dendritic cells during immune responses. The Trem2^{R47H NSS} mutation is one of the strongest genetic risk factors for late-onset Alzheimer's disease.

To create the Trem2^{R47H NSS} allele, CRISPR/Cas9 endonuclease-mediated genome editing of Trem2 was used to introduce a R47H mutation. R47H is homologous to the human R47H SNP shown to correlate with increased risk of late-onset Alzheimer's disease.

RNA-seq analysis of hippocampus and cortex indicates that the Trem2^{R47H NSS} allele is expressed at a level similar to the wild-type Trem2 allele, with no evidence of cryptic splicing products from the mutant allele.

Both heterozygous and homozygous mice are viable and fertile.

When crossed to 5xFAD mice (Mmjax No. 34848), hemizygous 5xFAD/homozygous Trem2^{R47H NSS} (5xFAD/Trem2^{R47H NSS}) mice have reduced size and number of microglia that display impaired interaction with plaques at 4 months of age compared to microglia in age-matched 5xFAD hemizygous controls. This is associated with a suppressed inflammatory response but increased dystrophic neurites and axonal damage as measured by plasma neurofilament light chain (NfL) level. At 12 months of age, disease stage 5xFAD/Trem2^{R47H NSS} mice no longer display impaired plaque-microglia interaction or suppressed inflammatory gene expression, although NfL levels remain elevated, and a unique interferon-related gene expression signature is seen. Twelve-month old Trem2^{R47H NSS} mice also display LTP deficits and postsynaptic loss.

Development

Guide RNAs (gaagcactgggggagacgca and gtacatgacaccctcaagga) were designed to create a guanine to adenine missense mutation, resulting in an arginine to histidine change at amino acid 47 (R47H) of the triggering receptor expressed on myeloid cells 2 (Trem2) gene. This mutation R47H is homologous to the human R47H SNP shown to correlate with increased risk of late-onset Alzheimer's disease. Ten silent DNA mutations were also introduced. The crRNA, tracrRNA and CAS9 nuclease were complexed to form a RNP, then introduced into the cytoplasm of C57BL/6J-derived zygotes with well recognized pronuclei. Surviving embryos were transferred to pseudopregnant females. Progeny were screened by DNA sequencing to identify correctly targeted Trem2^{R47H NSS} pups, which were then bred to C57BL/6J mice (Stock No. 000664) for germline transmission. The Trem2^{R47H NSS} colony was backcrossed to C57BL/6J for a total of at least two generations. At some point during development these mice were also bred to 5xFAD Tg mice (Stock No. 008730). The 5xFAD Tg was bred out of the mice that were shipped to The Jackson Laboratory. Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

Allele

Symbol: Trem2^em1Aduci
Name: endonuclease-mediated mutation 1, Frank LaFerla
MGI accession ID: MGI:6470973
Generation method: Endonuclease-mediated
Attributes: Humanized sequence
Synonyms: Trem2*R47H^NSS; Trem2^R47H; Trem2^{R47H NSS}
Marker symbol: Trem2
Marker name: triggering receptor expressed on myeloid cells 2
Marker synonyms: AD17; PLOSL2; TREM-2; Trem2a; Trem2b; Trem2c; Trem2-Mia; Trem2-Mib
Chromosome: 17
Strain of origin: C57BL/6J
Molecular note: Guide RNAs (gaagcactgggggagacgca and gtacatgacaccctcaagga) are designed to create a guanine to adenine missense mutation, resulting in an arginine to histidine change at amino acid 47 (R47H). This mutation R47H is homologous to the human R47H SNP shown to correlate with increased risk of late-onset Alzheimer's disease. Ten silent DNA mutations were also introduced.