BALB/cByJ-Rag2^em5Lutzy/J

Stock number: 033534
Product name: Rag2 KO
Research areas: Immunology, Inflammation and Autoimmunity Research, Research Tools

Description

This CRISPR/Cas9 generated mutant of the Rag2 gene possesses a knock-out of exon 3 (2449 nt deletion). These mice may be useful in studying B and T call deficiency as well as for xenograft/transplantation.

Detailed description

The recombination activating gene 2 gene (Rag2) encodes a protein that is part of the multiprotein RAG complex which is involved in V(D)J recombination. Mutations in this gene have been useful to study immune deficiency, cancer, toxicology and xenograft/transplant research.

To create the Rag2 KO allele, CRISPR/Cas9 endonuclease-mediated genome editing of Rag2 exon3 was used to introduce a 2449-nt deletion that resulted in the complete loss of exon3.

If additional characterization of these Rag2 KO mice is performed, we may modify the strain description accordingly.

Both heterozygous and homozygous mice are viable and fertile.

Development

The Rag2 KO allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing at The Jackson Laboratory. Guide RNAs were selected to target upstream [AGCCAGTCCGCCACTAAAAT ; GACCTATTTTAGTGGCGGAC] and downstream [CCCCCCGGTTACTTGTGATT ; CACCTAATCACAAGTAACCG] of exon3 of the recombination activating gene 2 locus (Rag2) on Chromosome 2.

Donor DNAs were created. Rag2 transcript Rag2-201 was used as reference for the exon numbering and the guide/donor sequences. These sequences and Cas9 nuclease were introduced into BALB/cByJ zygotes, and then transferred to pseudopregnant females. Progeny were screened by DNA sequencing of the targeted region, which identified founder 4341 harboring a 2449-nt deletion that resulted in the complete loss of exon3. This founder was bred to BALB/cByJ mice (Stock No. 001026) for germline transmission. The Rag2 KO (Rag2 del2449) colony was backcrossed to BALB/cByJ for a total of at least two generations.

Allele

Symbol: Rag2^em5Lutzy
Name: endonuclease-mediated mutation 5, Cathy Lutz
MGI accession ID: MGI:6877074
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Marker symbol: Rag2
Marker name: recombination activating gene 2
Marker synonyms: Rag-2
Chromosome: 2
Strain of origin: BALB/cByJ
Molecular note: CRISPR/cas9 genome editing used guide RNAs to target upstream [AGCCAGTCCGCCACTAAAAT ; GACCTATTTTAGTGGCGGAC] and downstream [CCCCCCGGTTACTTGTGATT ; CACCTAATCACAAGTAACCG] of exon 3. Progeny were screened by DNA sequencing of the targeted region, which identified founder 4341 harboring a 2449-nt deletion that resulted in the complete loss of exon 3.