NOD/ShiLtJ-Il2rg^em8Lutzy/J

Stock number: 033403
Product name: NOD.Il2rg KO (Il2rg Del328)
Research areas: Cancer Research, Diabetes and Obesity Research, Hematological Research, Immunology, Inflammation and Autoimmunity Research, Internal/Organ Research, Research Tools, Virology Research

Description

NOD.Il2rg KO (Il2rg Del328) is a CRISPR/Cas9 generated mutant of the interleukin 2 receptor, gamma chain locus carrying a 328-nt deletion encompassing exon 3. Il2rg KO mice may be useful for studying NK cell development, innate immunity, T and B cell deficiency and xenograft/transplant research.

Detailed description

To create this Il2rg KO allele (Il2rg Del328), CRISPR/Cas9 endonuclease-mediated genome editing of the interleukin 2 receptor, gamma chain locus (Il2rg) resulted in a 328-nt deletion encompassing exon 3 (as well as 70bp upstream and 73bp downstream).

These NOD.Il2rg KO mice (homozygous females and hemizygous males) are viable and fertile with significantly reduced numbers of T and B cells, and lack NK cells.
Specifically, analyses performed by The Jackson Laboratory in 2021 on circulating lymphocyte populations from NOD.Il2rg KO and NOD/ShiLtJ controls show the NOD.Il2rg KO had greatly reduced T cells, almost no mature B cells (a small percentage of immature B cells remain) and were essentially devoid of NK cells. In the reduced T cell population, the CD4+ fraction is slightly elevated, whereas the CD8+ fraction is slightly decreased. All these results were not significantly different than those observed for other Il2rg KO mice (Stock No. 003174) in the same study.

The Il2rg gene encodes IL2Rγ, an important signaling component of many interleukin receptors, and is thus referred to as the common gamma chain. IL2Rγ null mice may be useful for studying NK cell development, innate immunity, T and B cell deficiency and xenograft/transplant research.

Development

The Il2rg KO allele (Il2rg Del328) was generated using CRISPR/Cas9 endonuclease-mediated genome editing at The Jackson Laboratory. Guide RNAs were selected to target upstream [GACCAGATGAGGCTAGCTAA ; GCCCATTAGCTAGCCTCATC] and downstream [GTTTATAGATTGTTGGCCAT ; TATCTTCTCTTTTCTGCCCA] of exon 3 of the interleukin 2 receptor, gamma chain gene (Il2rg) on Chromosome X. Il2rg transcript Il2rg-201 was used as reference for the exon number and the guide sequences. These guides and cas9 nuclease were introduced into single cell NOD/ShiLtJ zygotes (Stock No. 001976) and transferred to pseudopregnant females. DNA sequencing of the targeted region identified one male (founder 2671) harboring a 328-nt deletion that resulted in the complete loss of exon 3 (as well as 70bp upstream and 73bp downstream). This founder was bred to NOD/ShiLtJ mice (Stock No. 001976) for germline transmission. They were then bred to NOD/ShiLt for at least one more generation.

Allele

Symbol: Il2rg^em8Lutzy
Name: endonuclease-mediated mutation 8, Cathy Lutz
MGI accession ID: MGI:6763016
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Synonyms: Il2rg Del328
Marker symbol: Il2rg
Marker name: interleukin 2 receptor, gamma chain
Marker synonyms: [g]c; Ab2-183; Cd132; CIDX; common cytokine receptor gamma chain; common gamma chain; gamma C receptor; gamma(c); gammaC; gc; IL-2RG; IMD4; P64; SCIDX; SCIDX1
Chromosome: X
Strain of origin: NOD/ShiLtJ
Molecular note: CRISPR/cas9 genome editing is used to create a 328 nt deletion resulting in complete loss of exon 3 (as well as 70bp upstream and 73bp downstream). Il2rg transcript Il2rg-201 was used as reference for the exon number and the guide sequences.