BALB/cByJ-Il2rg^em5Lutzy/J

Stock number: 033399
Product name: Il2rg KO
Research areas: Cancer Research, Immunology, Inflammation and Autoimmunity Research, Research Tools

Description

This CRISPR/Cas9 generated mutant of the Il2rg gene possesses a knock-out of exon 3. These mice may be are useful when studying NK cell development and innate immunity.

Detailed description

The interleukin 2 receptor, gamma chain gene (Il2rg) encodes IL2Rγ, an important signaling component of many interleukin receptors, and is thus referred to as the common gamma chain. IL2Rγ null mice may be useful for studying NK cell development, innate immunity, T and B cell deficiency and xenograft/transplant research.

To create the Il2rg KO allele, CRISPR/Cas9 endonuclease-mediated genome editing of Il2rg exon3 was used to create a complete loss of exon3.

If additional characterization of these Il2rg KO mice is performed, we may modify the strain description accordingly.

Both heterozygous and homozygous mice are viable and fertile.

Development

The Il2rg KO allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing at The Jackson Laboratory. Guide RNAs were selected to target upstream [GACCAGATGAGGCTAGCTAA ; GCCCATTAGCTAGCCTCATC] and downstream [GTTTATAGATTGTTGGCCAT ; TATCTTCTCTTTTCTGCCCA] of exon 3 of the interleukin 2 receptor, gamma chain locus (Il2rg) on the X Chromosome. Donor DNAs were created. Il2rg transcript Il2rg-201 was used as reference for the exon numbering and the guide/donor sequences. These sequences and Cas9 nuclease were introduced into BALB/cByJ zygotes, and then transferred to pseudopregnant females. Progeny were screened by DNA sequencing of the targeted region, which identified a founder harboring a complete loss of exon3. This founder was bred to BALB/cByJ mice (Stock No. 001026) for germline transmission. The Il2rg KO colony was backcrossed to BALB/cByJ for a total of at least two generations.

Allele

Symbol: Il2rg^em5Lutzy
Name: endonuclease-mediated mutation 5, Cathy Lutz
MGI accession ID: MGI:6877078
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Marker symbol: Il2rg
Marker name: interleukin 2 receptor, gamma chain
Marker synonyms: [g]c; Ab2-183; Cd132; CIDX; common cytokine receptor gamma chain; common gamma chain; gamma C receptor; gamma(c); gammaC; gc; IL-2RG; IMD4; P64; SCIDX; SCIDX1
Chromosome: X
Strain of origin: BALB/cByJ
Molecular note: CRISPR/cas9 genome editing is used to delete exon 3. Guide RNAs were selected to target upstream [GACCAGATGAGGCTAGCTAA ; GCCCATTAGCTAGCCTCATC] and downstream [GTTTATAGATTGTTGGCCAT ; TATCTTCTCTTTTCTGCCCA] of exon 3. Progeny were screened by DNA sequencing of the targeted region, which identified a founder harboring a complete loss of exon3.