C57BL/6J-Trem2^em3Bwef/J

Stock number: 033371
Product name: Trem2*H157Y , Trem2^H157Y
Research areas: Cell Biology Research, Immunology, Inflammation and Autoimmunity Research, Mouse/Human Gene Homologs, Neurobiology Research

Description

Trem2*H157Y is a CRISPR/Cas9-made knock-in allele with a H157Y mutation in Trem2 exon 3 at the TREM2 cleavage site. The TREM2 H157Y mutation in human populations is associated with significantly increased risk of Alzheimer's disease (AD). These Trem2*H157Y mice may be useful in studies of AD, neuroinflammation and neurodegeneration.

Detailed description

The triggering receptor expressed on myeloid cells 2 gene (Trem2) encodes a protein that is part of a receptor signaling complex with TYRO protein tyrosine kinase binding protein (TYROBP2; DNAX Adaptor Protein 12, DAP12), and that activates macrophages and dendritic cells during immune responses. Loss-of-function and sequence variations of the TREM2 gene in human populations indicate an essential function of microglia and innate immunity in the pathogenesis of Alzheimer's disease (AD) and other neurodegenerative disorders. Specifically, a mutation at the TREM2 cleavage site (H157Y) is associated with significantly increased AD risk [Schlepckow et al. 2017 EMBO Mol Med 9:1356 (PMID:28855300)].

Trem2*H157Y is a CRISPR/Cas9-made knock-in allele with a H157Y mutation in Trem2 exon 3 at the TREM2 cleavage site. The donating investigator reports that mice homozygous for this Trem2*H157Y mutation are viable, fertile, normal in size and do not display any gross physical or behavioral abnormalities. Overall levels of TREM2 mRNA expression are unchanged in the brain. Additional analyses of these mice are in progress [September 2019]. If these mice are further characterized, we may modify the strain description and/or add phenotype data.

Development

The Trem2*H157Y knock-in allele was created by the laboratory of Dr. Christian Haass (Ludwig-Maximilians University Munich) using CRISPR/Cas9 endonuclease-mediated genome editing in C57BL/6J cells. A single guide RNA (sgRNA; protospacer GAGTTTCGAGGGTGCCCAAGTGG) was designed to target sequences in exon 3 of the triggering receptor expressed on myeloid cells 2 locus (Trem2) on chromosome 17. Single-stranded oligodeoxynucleotide (ssODN) donor DNAs encoding the Trem2 H157Y (C-to-T nucleotide) substitution were obtained (TCCTTTGCTGATCTGTTTGCCCTGGGACCTCCATCCGCAGTCACTGCCAGGGGGTCTAAGAAGGGACCACTACTGTACCTGGAGGTGCTGTaTTCgACTTGtGCACCCTCGAAACTCGATGACTCCTCGGGGACCCAG). Two additional silent nucleotide exchanges within the protospacer/PAM region created an ApaLI restriction site for genotyping purposes. Founder mice were screened by PCR and sequencing to confirm the Trem2*H157Y knock-in allele had the nucleotide substitution (C-to-T) in Trem2 exon 3 that results in the amino acid substitution H157Y at the TREM2 cleavage site (as well as the ApaLI restriction site for genotyping purposes). Founder mice were bred to wildtype C57BL/6J mice for germline transmission. The donating investigator reports the Trem2*H157Y knock-in colony was then maintained on C57BL/6J genetic background by breeding homozygous mice together, and analysis revealed no off-target mutations. They also report that the Trem2*H157Y colony was bred with an APPPS1 transgenic mouse line [Tg(Thy1-APPSw,Thy1-PSEN1*L166P)21Jckr] on the C57BL/6J background and that APPPS1 transgene was not present in the heterozygous males (black coat color) sent to The Jackson Laboratory in 2020. Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. 000664).

Allele

Symbol: Trem2^em3Bwef
Name: endonuclease-mediated mutation 3, Benedikt Wefers
MGI accession ID: MGI:6295472
Generation method: Endonuclease-mediated
Attributes: Not Specified
Synonyms: Trem2 p.H157Y; Trem2(H157Y); Trem2^{em3(H157Y)Bwef}
Marker symbol: Trem2
Marker name: triggering receptor expressed on myeloid cells 2
Marker synonyms: AD17; PLOSL2; TREM-2; Trem2a; Trem2b; Trem2c; Trem2-Mia; Trem2-Mib
Chromosome: 17
Strain of origin: C57BL/6J
Molecular note: CRISPR/Cas9-mediated homologous recombination using a synthetic oligodeoxynucleotide created a nucleotide substitution (C to T) in exon 3 of Trem2 that results in the amino acid substitution H157Y. Two additional silent nucleotide exchanges within the protospacer/PAM region created an ApaLI restriction site for genotyping purposes.