B6.FVB-Nxph4^em1(cre)Zak/J

Stock number: 033354
Product name: Nxph4-2a-Cre
Research areas: Neurobiology Research, Research Tools

Description

Nxph4-2a-Cre knock-in mice express Cre recombinase from the mouse Nxph4 (neurexophilin 4) promoter. Cre activity recapitulates that of the endogenous Nxph4 gene in the brain. These mice may be useful in studies of study thirst, thermoregulation, and other processes regulated by neurons expressing Nxph4.

Detailed description

These Nxph4-2a-Cre knock-in mice express T2A-cre recombinase from the mouse Nxph4 (neurexophilin 4) promoter. Crosses with floxed GFP ribosomal reporter mice (see stock 022367) indicate that cre activity recapitulates that of the endogenous Nxph4 gene throughout the brain, including the organum vasculosum of the lamina terminalis (OVLT), median preoptic nucleus (MnPO), subfornical organ (SFO), and paraventricular hypothalamus (PVH). Expression of the endogenous Nxph4 mRNA for protein has not been examined. These mice have been used to gain genetic access to thirst-promoting neurons in the MnPO, which is a crucial node in the brain's fluid homeostasis system.

Development

CRISPR/Cas9 (sgRNA sequence: GAGTGAGACTGCGATCTGGT) was used to insert T2A-Cre sequence immediately upstream of the endogenous Nxph4 stop codon. The guide sequence was separated from the protospacer adjacent motif (PAM) site in the genomic DNA by the T2A-Cre insertion to ensure that the targeting vector and recombined Nxph4-2a-Cre allele was protected from Cas9 nuclease activity. T2A (viral 2A oligopeptide sequence) mediates ribosomal skipping. The mutation was created in FVB/N mice. This strain was backcrossed to C57BL/6J for 9 generations by the donating laboratory.

Allele

Symbol: Nxph4^em1(cre)Zak
Name: endonuclease-mediated mutation 1, Zachary Knight
MGI accession ID: MGI:6285704
Generation method: Endonuclease-mediated
Attributes: Recombinase-expressing
Marker symbol: Nxph4
Marker name: neurexophilin 4
Chromosome: 10
Strain of origin: FVB/N
Molecular note: CRISPR/Cas9 was used to insert T2A-Cre sequence immediately upstream of the endogenous Nxph4 stop codon. The mutation was created in FVB/N mice.