C57BL/6-Lyve1^{em1(Ncre)Jung} Cx3cr1^{em1(Ccre)Jung}/J

Stock number: 033319
Product name: Lyve1^ncre:Cx3cr1^ccre
Research areas: Neurobiology Research, Research Tools

Description

These Lyve1^ncre:Cx3cr1^ccre (CX/Lyve1) mice use a binary transgenic Cre approach to dissect functions of central nervous system (CNS) macrophage subpopulations.

Detailed description

These Lyve1^ncre:Cx3cr1^ccre (CX/Lyve1) mice use a binary transgenic Cre approach to dissect functions of central nervous system (CNS) macrophage subpopulations.

The lymphatic vessel endothelial hyaluronan receptor 1 (Lyve1) gene is expressed on vessel-associated macrophages, including a perivascular border associated macrophage (BAM) subset in the CNS, and it is also prominently expressed on lymphatic endothelium. The Lyve1^ncre allele carries a gene encoding the N-terminal fragment of Cre recombinase downstream of the Lyve1 gene. This 40 aa NCre peptide lacks the enzymatic active site, yet it harbors a coiled-coil leucine zipper dimerization domain.

The chemokine (C-X3-C motif) receptor 1 (Cx3cr1) gene encodes a chemokine receptor which is broadly active in macrophages including their precursors, but also other immune cells, such as selected lymphocytes. The Cx3cr1^ccre allele carries the C-terminal fragment of Cre recombinase downstream of the Cx3cr1 gene. This 283 aa CCre fragment contains the enzymatic active site of Cre recombinase as well as a coiled-coil leucine zipper dimerization domain, yet it lacks recombinase activity.

In this binary transgenic cre strain, Lyve1^ncre:Cx3cr1^ccre, NCre and CCre co-expression reconstitutes a functional enzyme complex. To retain expression of the endogenous loci following the insertion of the NCre and CCre fragments, 2A self cleaving peptides were included at the fusion sites.

In Lyve1^ncre:Cx3cr1^ccre mice, Cre recombinase activity is specifically targeted to vasculature-associated macrophages, in the brain, as well as other tissues. Double homozygotes are viable and fertile. When these mice are bred with mice containing loxP-flanked sequence, cre-mediated recombination will result in deletion of the floxed sequences in the NCre- and CCre-expressing cells of the offspring.

Specifically, the donating investigator's publications [PMID:33333014, PMID:36747024, PMID:37639143] show that Lyve1^ncre:Cx3cr1^ccre mice in combination with the Cre-inducible tdTomato fluorescent reporter (Ai9; Stock No. 007909) exhibit efficient Cre recombinase activity (tdTomato expression) in CNS macrophage subpopulations. Additionally, the donating investigator reports some floxed alleles may not recombine as efficiently, perhaps due to differences in their accessibility for rearrangement.

Importantly, only if both Lyve1 and Cx3cr1 promoters are active will the functional complementation take place (i.e., NCre/CCre dimerization creating a functional Cre molecule). The necessary overlap of NCre/CCre expression might not be reached due to temporally limited or unsynchronized transcriptional bursts of the two promoters. See PMID:37639143 Figure 2 for scenarios explaining dissociation of phenotype and genotype of splitCre-targeted cells.

Of note, Stock No. 033319 has white belly spots.

Development

Guide RNAs (TCCTAGTGGAGCTAGGGTCGGGG) were designed to insert a cassette encoding a viral 2A oligopeptide (T2A) self cleaving peptide, that mediates ribosomal skipping, fused to a C-terminal Cre recombinase fragment (CCre), directly downstream of the chemokine (C-X3-C motif) receptor 1 (Cx3cr1) gene. The crRNA, tracrRNA and CAS9 nuclease were complexed to form an ctRNP, then introduced into the cytoplasm of C57BL/6JOlaHsd-derived zygotes with well recognized pronuclei. Surviving embryos were transferred to pseudopregnant females. Progeny were screened by DNA sequencing to identify correctly targeted pups, which were then bred to C57BL/6JOlaHsd mice for germline transmission.

Another set of guide RNAs (GAAGTTTAGATGCAAGAGAGGTGG) were designed to insert a cassette encoding a viral 2A oligopeptide (T2A) peptide fused to an N-terminal Cre recombinase fragment (NCre), directly downstream of the lymphatic vessel endothelial hyaluronan receptor 1 (Lyve1) gene. The crRNA, tracrRNA and CAS9 nuclease were complexed to form an ctRNP, then introduced into the cytoplasm of C57BL/6JOlaHsd-derived zygotes with well recognized pronuclei. Surviving embryos were transferred to pseudopregnant females. Progeny were screened by DNA sequencing to identify correctly targeted pups, which were then bred to C57BL/6JOlaHsd mice for germline transmission. Mice carrying the Cx3cr1^ccre allele and mice carrying the Lyve1^ncre were bred together to produce this Lyve1^ncre:Cx3cr1^ccre (CX/Lyve1) strain. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. 000664).

In 2021, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the males sent to The Jackson Laboratory Repository. Two of the 5 markers that determine C57BL/6J from C57BL/6N, on chromosomes 6, 8, and 19, were found to be segregating. These data suggest the mice sent to The Jackson Laboratory Repository were on a mixed C57BL/6N;C57BL/6J genetic background.

Allele

Symbol: Lyve1^{em1(Ncre)Jung}
Name: endonuclease-mediated mutation 1, Steffen Jung
MGI accession ID: MGI:6508985
Generation method: Endonuclease-mediated
Attributes: Recombinase-expressing
Synonyms: Lyve1^ncre
Marker symbol: Lyve1
Marker name: lymphatic vessel endothelial hyaluronan receptor 1
Marker synonyms: 1200012G08Rik; CRSBP-1; HAR; lymphatic vessel endothelial HA receptor-1; Lyve-1; XLKD1
Chromosome: 7
Strain of origin: C57BL/6JOlaHsd
Molecular note: CRISPR/Cas9 system inserted a cassette encoding a viral 2A oligopeptide (T2A) self-cleaving peptide, that mediates ribosomal skipping, fused to an N-terminal Cre recombinase fragment (NCre), directly downstream of the lymphatic vessel endothelial hyaluronan receptor 1 (Lyve1) gene.

Allele

Symbol: Cx3cr1^{em1(Ccre)Jung}
Name: endonuclease-mediated mutation 1, Steffen Jung
MGI accession ID: MGI:6508987
Generation method: Endonuclease-mediated
Attributes: Recombinase-expressing
Synonyms: Cx3cr1^ccre
Marker symbol: Cx3cr1
Marker name: chemokine (C-X3-C motif) receptor 1
Marker synonyms: CCRL1; CMKBRL1; CMKDR1; GPR13; GPRV28; Rbs11; V28
Chromosome: 9
Strain of origin: C57BL/6JOlaHsd
Molecular note: CRISPR/Cas9 system inserted a cassette encoding a viral 2A oligopeptide (T2A) self-cleaving peptide, that mediates ribosomal skipping, fused to an C-terminal Cre recombinase fragment (CCre), directly downstream of the chemokine (C-X3-C motif) receptor 1 (Cx3cr1) gene.