NOD/ShiLtJ-Cxcr6^em1Dvs/FrdmJ

Stock number: 033094
Product name: CXCR6^-
Research areas: Immunology, Inflammation and Autoimmunity Research

Description

These CRISPR-generated CXCR6^-/- mutant mice have a 7 base pair deletion in exon 2 of the chemokine (C-X-C motif) receptor 6 gene. These mice may be useful when studying T cell trafficking to inflamed islets during the progression of Type 1 diabetes.

Detailed description

These CRISPR-generated CXCR6^-/- mutant mice have a 7 base pair deletion in exon 2 of the chemokine (C-X-C motif) receptor 6 gene. CXCR6 is a chemokine receptor that binds to CXCL16, a chemokine expressed on islet T cells. T cells in these mice progress normally to Type 1 diabetes (T1D) and CXCR6-deficient T cells traffic normally to the islets. Similar to NOD/ShiLtJ inbred mice (Stock No. 001976), these CXCR6^- mutant mice (both homozygous and heterozygous) should be given CFA prior to six weeks of age to delay diabetes onset. These mice may be useful when studying T cell trafficking to inflamed islets during the progression of Type 1 diabetes.

Development

A CRISPR/Cas9-generated mutation was introduced to exon 2 of the chemokine (C-X-C motif) receptor 6 (Cxcr6) gene (gRNA CTCTTGATGCCCATCATCCA) resulting in a 7 base pair deletion. This strain was created in and maintained on the NOD/ShiLtJ genetic background by the donating laboratory. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize NOD/ShiLtJ oocytes (Stock No. 001976).

Allele

Symbol: Cxcr6^em1Dvs
Name: endonuclease-mediated mutation 1,David V Serreze
MGI accession ID: MGI:6273476
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Marker symbol: Cxcr6
Marker name: chemokine (C-X-C motif) receptor 6
Marker synonyms: BONZO; CD186; CDw186; STRL33; TYMSTR
Chromosome: 9
Strain of origin: NOD/ShiLtJ
Molecular note: CRISPR/Cas9-generated genome editing is used to introduce a 7 base pair deletion into exon 2.