C57BL/6NJ-Ttc38^em1Llp/LlpJ

Stock number: 032964

Description

This CRISPR/cas9-mediated deletion of much of exon 7 of tetratricopeptide repeat domain 38 was generated in the laboratory of Dr. Luanne Peters.

Detailed description

A tetratricopeptide repeat domain has 3-16 tandem repeats of a minimally conserved stretch of 34 amino acids centered around consensus residues, which has been found to form a helix-turn-helix and to mediate protein-protein interactions. There are many well characterized tetratricopeptide repeat domain proteins, but the function of Ttc38 has not yet been defined. Mice homozygous for this allele are viable and fertile.

Development

This allele was generated by Dr. Luanne Peters at The Jackson Laboratory by microinjection of Cas9 mRNA and 2 guide sequences, GCTCTCATTTCATGTACGT, GCAATCGGAAGGTCACTGGA, which resulted in a 62 bp deletion beginning at approximately Chromosome 15 position 85,844,505 bp, ACATGAAA, and ending after 85,844,566 bp, GGTCACT (GRCm38.p6/mm10). This mutation deletes much of ENSMUSE00001278296 (exon 7).

Allele

Symbol: Ttc38^em1Llp
Name: endonuclease-mediated mutation 1, Jackson
MGI accession ID: MGI:6259151
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Marker symbol: Ttc38
Marker name: tetratricopeptide repeat domain 38
Marker synonyms: LL22NC03-5H6.5; RGD1306041
Chromosome: 15
Strain of origin: C57BL/6NJ
Molecular note: This allele was generated by Dr. Luanne Peters at The Jackson Laboratory by microinjection of Cas9 mRNA and 2 guide sequences, GCTCTCATTTCATGTACGT, GCAATCGGAAGGTCACTGGA, which resulted in a 62 bp deletion beginning at approximately Chromosome 15 position 85,844,505 bp, ACATGAAA, and ending after 85,844,566 bp, GGTCACT (GRCm38.p6/mm10). This mutation deletes much of ENSMUSE00001278296 (exon 7).