NOD.Cg-Prkdc^scid H2-K1^d-em1Dvs H2-Ab1^g7-em1Dvs H2-D1^b-em5Dvs Il2rg^tm1Wjl/SzJ

Stock number: 032927
Product name: NSG-MHC I/II DKO (CRISPR/Cas9)
Strain synonyms: NSG Class I/II dKO, NSG-MHC I/II DKO, NSG-cMHCI/II-/-
Research areas: Cancer Research, Diabetes and Obesity Research, Immunology, Inflammation and Autoimmunity Research, Internal/Organ Research, Research Tools, Virology Research

Description

This strain has been discontinued. Please see Stock No. 025216.

NSG-MHC I/II DKO (CRISPR/Cas9) mutant mice have CRISPR-made knock-out alleles for the classical MHC class I genes (H2-K1 and H2-D1) and the class II gene (H2-Ab1 [I-A]), as well as the severe combined immune deficiency (scid) allele and a null allele of the IL2 receptor common gamma chain (Il2rg). This immunodeficient strain lacks MHC class I/II, as well as B, T and NK cells. This strain may be useful for human PBMC engraftment, acute GVHD and tumor engraftment experiments. It may also be suitable to develop HLA-humanized NOD models for use in T1D therapy development.

Detailed description

These NSG-MHC I/II DKO (CRISPR/Cas9) mice are also called NSG-cMHCI/II^-/-. These mice are NOD.scid;IL2rg-deficient (NSG) animals also containing null targeted mutation for mouse MHC class I genes (H2-K1 and H2-D1) and a CRISPR/Cas9-made null mutation for the mouse class II gene (H2-Ab1 [I-A]) - making them an MHC I/II double knock-out.

These NSG-MHC I/II DKO (CRISPR/Cas9) mice combine features of the severe combined immune deficiency mutation or scid (B and T cell deficiency), IL2 receptor gamma chain deficiency (NK cell deficiency), MHC class I molecule deficiency (H2-K and D) and MHC class II molecule deficiency (IA). Mice homozygous for the five mutations are viable, normal in size and do not display any gross physical or behavioral abnormalities - however, they should be considered immunodeficient. These mice do not spontaneously develop diabetes. This strain may be useful for human PBMC engraftment, acute graft-versus-host disease (GVHD) and tumor engraftment experiments. It may also be suitable to develop HLA-humanized NOD models for use in T1D therapy development.

Development

This strain was created by crossing NOD/ShiLtDvs-H2-K1^d-em1Dvs H2-Ab1^g7-em1Dvs H2-D1b-^em5Dvs/Dvs and NOD.Cg-Prkdc^scid Il2rg^tm1Wjl/SzJ (Stock No. 005557).

The MHC Class I H2-K^-/- and H2-D^-/- alleles (cMHCI) and the MHC Class II H2-Ab1 (cMHCII) allele (NOD/ShiLtDvs-H2-K1^em1Dvs H2-Ab1^em1Dvs H2-D1^em5Dvs/Dvs) were all created by Dr. David Serreze (The Jackson Laboratory). For the cMHCI alleles, guide RNA was designed to delete a single nucleotide in exon 2 of the H2-K1 gene and two deletions (11 bp and 3 bp) in exon 2 of the H2-D1 gene. The sgRNA and Cas9 endonuclease were introduced into NOD/ShiLtDvs-derived fertilized eggs by pronuclear injection. Embryos were transferred to pseudopregnant females, and correctly targeted pups (identified by sequencing) were bred to NOD/ShiLtDvs inbred mice for germline transmission. Null phenotypes were confirmed by flow cytometry.

CRISPR/Cas9 methodology was then used to delete a 181 bp region in exon 2 of the H2-Ab1 gene. The sgRNA and Cas9 endonuclease were introduced by pronuclear injection into zygotes derived from NOD/ShiLtDvs-H2-K1^d-em1Dvs H2-D1^b-em5Dvs/Dvs (NOD-cMHCI^-/-) females. Embryos were transferred to pseudopregnant females, and correctly targeted pups (identified by sequencing) were bred to NOD-cMHCI^-/- for germline transmission to create this MHCI/II^- knock-out colony. Null phenotypes were confirmed by flow cytometry.

Mice from the NOD-MHCI/II^-/- colony were than crossed to NOD.Cg-Prkdc^scid Il2rg^tm1Wjl/SzJ (Stock No. 005557). With the exception of the X-linked Il2rg allele, all four other mutant alleles were made homozygous by breeding.

Allele

Symbol: H2-Ab1^g7-em1Dvs
Name: endonuclease-mediated mutation 1, Jackson
MGI accession ID: MGI:6101479
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Synonyms: H2-Ab1^em1Dvs
Marker symbol: H2-Ab1
Marker name: histocompatibility 2, class II antigen A, beta 1
Marker synonyms: A beta; Abeta; Bb; CELIAC1; DQB2; H-2Ab; H2-Ab; HLA-DQB; HLA-DQB1; HLA-DXB; I-A^b; Ia2; Ia-2; IAb; I-Abeta; IDDM1; Rmcs1; RT1.B
Chromosome: 17
Strain of origin: NOD/ShiLtDvs-H2-K1^d-em1Dvs H2-D1^b-em5Dvs/Dvs
Molecular note: Cas9 RNA and four guide sequences targeting Exon 2 (CCAACGGGACGCAGCGCATA, CGAAGCGCAGGTACTCCTCC, CGACGTGGGCGAGTACCGCG, ACACAACTACGAGGAGACGG) were injected into NOD/ShiLtDvs-H2-K1^em1Dvs H2-D1^em5Dvs/Dvs embryos yielding this 181bp deletion (ATACGGCTCGTGACCAGATACATCTACAACCGGGAGGAGTACCTGCGCTTCGACAGCGACGTGGGCGAGTACCGCGCGGT GACCGAGCTGGGGCGGCACTCAGCCGAGTACTACAATAAGCAGTACCTGGAGCGAACGCGGGCCGAGCTGGACACGGCGT GCAGACACAACTACGAGGAGA) within Exon 2 of H2-Ab1. Flow cytometry showed a paucity of CD8+ and CD4+ T-cells in the blood, and flow cytometry showing loss of H2-D, H2-K, and I-A on blood B-cells.

Allele

Symbol: H2-K1^d-em1Dvs
Name: endonuclease-mediated mutation 1, David V Serreze
MGI accession ID: MGI:6119459
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Synonyms: H2-K1^em1Dvs
Marker symbol: H2-K1
Marker name: histocompatibility 2, K1, K region
Marker synonyms: AS; B-4901; CDA12; D6S204; H-2K; HLA-5.4; HLA-6.2; HLAA; HLAB; HLAC; HLA-CDA12; HLAF; HLAHP; HLA-JY3; HLC-C; MHC; MHC-G; PSORS1; QA1; RT1.A2(N); RT1.Cg; RT1A-2; RT1-A2n; RT1-C/E1; RT1-C/E2; RT1-CE12; RT1-Uav1; RT1-Uc; RT1-Ulv1
Chromosome: 17
Strain of origin: NOD/ShiLtDvs
Molecular note: This single nucleotide (G) deletion within exon 2 was shown by flow cytometry to cause a null allele. it was generated by injection of Cas9 and guide sequences GTACATCTCTGTCGGCTATG targeting H2-D1^b and ATAATCCGAGATTTGAGCCG targeting H2-K1^d into NOD/ShiLtDvs embryos, which resulted in this point deletion and the intragenic deletions of H2-D1^em5Dvs.

Allele

Symbol: Prkdc^scid
Name: severe combined immunodeficiency
MGI accession ID: MGI:1857113
Generation method: Spontaneous
Synonyms: scid
Marker symbol: Prkdc
Marker name: protein kinase, DNA activated, catalytic polypeptide
Marker synonyms: DNAPDcs; DNAPK; DNA-PK; DNAPKc; DNA-PKC; DNA-PKcs; DNPK1; DOXNPH; dxnph; HYRC; HYRC1; IMD26; p350; S473K; slip; XRCC7
Chromosome: 16
Strain of origin: C.BKa-Igh^b/Icr
Site of expression: T and B lymphocytes.
Molecular note: A T-to-A transversion point mutation at a position corresponding to codon 4046 (codon 4095 in transcript ENSMUST00000023352.8) created a premature stop codon (p.Y4046*).

Allele

Symbol: Il2rg^tm1Wjl
Name: targeted mutation 1, Warren J Leonard
MGI accession ID: MGI:1857455
Generation method: Targeted
Attributes: Null/Knockout
Synonyms: [KO]gammac; CD132^-; gammac^-; gc^-; Il2rg^tm1Wjll; IL2Rgamma^null
Marker symbol: Il2rg
Marker name: interleukin 2 receptor, gamma chain
Marker synonyms: [g]c; Ab2-183; Cd132; CIDX; common cytokine receptor gamma chain; common gamma chain; gamma C receptor; gamma(c); gammaC; gc; IL-2RG; IMD4; P64; SCIDX; SCIDX1
Chromosome: X
Strain of origin: 129S4/SvJae
Site of expression: Primarily lymphoid cells.
Molecular note: A neomycin resistance cassette replaced part of exon 3 and all of exons 4 - 8 of the gene, resulting in the loss of most of the extracellular domain and all of the transmembrane and cytoplasmic domains of the protein.

Allele

Symbol: H2-D1^b-em5Dvs
Name: endonuclease-mediated mutation 5, David V Serreze
MGI accession ID: MGI:6119467
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Marker symbol: H2-D1
Marker name: histocompatibility 2, D region locus 1
Marker synonyms: AS; B-4901; CDA12; D6S204; H-2D; HLA-5.4; HLA-6.2; HLAA; HLAB; HLAC; HLA-CDA12; HLAF; HLAHP; HLA-JY3; HLC-C; MHC; MHC-G; PSORS1; QA1; RT1.A2(N); RT1.Cg; RT1A-2; RT1-A2n; RT1-C/E1; RT1-C/E2; RT1-CE12; RT1-Uav1; RT1-Uc; RT1-Ulv1
Chromosome: 17
Strain of origin: NOD/ShiLtDvs
Molecular note: Cas9 and guide sequences GTACATCTCTGTCGGCTATG targeting H2-D1^b and ATAATCCGAGATTTGAGCCG targeting H2-K1^d were injected into NOD/ShiLtDvs embryos resulting in two deletions in exon 2, one 11 bp and one 3 bp, in addition to the single nucleotide deletion that is H2-K1^em1Dvs.