CBA.Cg-Csf1r^em1Prdns/J

Stock number: 032783
Product name: Csf1r^ΔFIRE
Research areas: Cell Biology Research, Immunology, Inflammation and Autoimmunity Research, Research Tools

Description

Csf1r^ΔFIRE has a 418 bp deletion downstream of exon 2, including the fms-intronic regulatory element (FIRE), of the Csf1r gene. This strain may be useful for studying tissue-specific macrophage transcriptional regulation and function.
This strain ships with remnant UID MiniMax microchips implanted subcutaneously in the back. For more information on these RFID chips, including our FAQ, please visit our Mouse Identification page.

Of note, a similar Csf1r^ΔFIRE allele on a C57BL/6J genetic background is available as Stock No. 041479.

Detailed description

Csf1r^{ΔFIRE/ΔFIRE} mice have a 418 bp deletion downstream of exon 2, including the fms-intronic regulatory element (FIRE), of the colony stimulating factor 1 receptor (Csf1r) gene. Csf1r encodes Cd115 which acts as the receptor for colony stimulating factor 1, a cytokine which controls the production, differentiation, and function of macrophages. The mouse FIRE sequence contains binding sites for numerous macrophage-expressed transcription factors.

Specifically, Csf1r^{ΔFIRE/ΔFIRE} mice lack macrophages in the embryo, and brain microglia and resident macrophages in the skin, kidney, heart and peritoneum. The homeostasis of other macrophage populations and monocytes is unaffected, but monocytes and their progenitors in bone marrow lack surface CSF1R.

Csf1r^{ΔFIRE/ΔFIRE} mice are healthy and fertile without the growth or developmental abnormalities seen in Csf1r deficient mice. The donating investigator reports that homozygous Csf1r^{ΔFIRE/ΔFIRE} mice are viable and fertile, yet homozygous females do not look after their pups well.

When this allele is maintained on a congenic C57BL/6J genetic background, mice develop hydrocephalus (HC) by 2 weeks of age.

It is the experience of colonists at The Jackson Laboratory that homozygous mice are born at a lower Mendelian ration than expected from a heterozygous colony. Also, homozygous mice are frequently born with small or missing eyes, and a majority of those mice exhibit a conjunctivitis-like phenotype but are otherwise healthy. This may be due to the Pde6b^rd1 retinal degeneration mutation found in CBA/J inbred mice (September 2024). For these reasons this colony is maintained by breeding heterozygous mice together.

Of note, a similar Csf1r^ΔFIRE allele on a C57BL/6J genetic background is available as Stock No. 041479.

Development

Guide RNAs (US1: GAGTCCCTCAGTGTGTGAGA and DS2: CAATGAGTCTGTACTGGAGC) and oligo donor DNAs were designed to introduce a 418 bp deletion downstream of exon 2, including the fms-intronic regulatory element (FIRE), of the colony stimulating factor 1 receptor (Csf1r) gene. Guide RNAs, donor DNAs, and Cas9 nuclease mRNA were introduced into the cytoplasm of C57BL/6J/CBA F1-derived fertilized eggs with well recognized pronuclei. Correctly targeted embryos were transferred to pseudopregnant females. One resulting Csf1r^ΔFIRE founder male was identified by PCR and sequencing and was bred to C57BL/6JCrl females. The offspring were then interbred and were subsequently backcrossed onto the CBA/Ca (Stock No. 000654) mice for at least 10 generations by the donating laboratory. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize CBA/CaJ oocytes.

Allele

Symbol: Csf1r^em1Prdns
Name: endonuclease-mediated mutation 1, Clare Pridans
MGI accession ID: MGI:6833870
Generation method: Endonuclease-mediated
Attributes: Modified regulatory region
Synonyms: Csf1r^deltaFIRE
Marker symbol: Csf1r
Marker name: colony stimulating factor 1 receptor
Marker synonyms: BANDDOS; CD115; c-fms; CSF-1R; CSF-1-R; Csfmr; CSFR; Fim2; Fim-2; Fms; GPSC; HDLS; HDLS1; M-CSFR; M-CSF-R; mrfms
Chromosome: 18
Strain of origin: (C57BL/6J x CBA/J)F1
Molecular note: Guide RNAs (equivalent to GAGTCCCTCAGTGTGTGAGA and CAATGAGTCTGTACTGGAGC) were designed to introduce a 418 bp deletion in intron 2, which includes the fms-intronic regulatory element (FIRE).