C57BL/6-Rr174^em1Kmm/J

Stock number: 032746
Product name: Irf8 -50^-
Strain synonyms: C57BL/6J-Irf8^em3Kmm/J
Research areas: Cell Biology Research, Immunology, Inflammation and Autoimmunity Research

Description

Irf8 -50^-/- mice have a CRISPR/Cas9-generated deletion of an enhancer located upstream of the transcriptional start site of the interferon regulatory factor 8 (Irf8) gene making this strain useful when studying the role of macrophages in host defense.

Detailed description

CRISPR/cas9 endonuclease mediated genome editing of the interferon regulatory factor 8 (Irf8) gene was used to delete an enhancer located at -50 kb upstream from the transcriptional start site. IRF8 encodes a transcription factor required for classical type 1 dendritic cell (cDC1) fate specification. These mice have a 364 bp deletion that eliminates both of the PU.1-binding sites, which are involved in the differentiation and activation of monocyte and dendritic cell (DC) progenitors (MDP). These mice have normal numbers of "classical" DCs (cDCs), plasmacytoid DCs (pDCs), neutrophils, B cells, T cells and red pulp macrophages. Monocytes are present at normal numbers, but show reduced intracellular IRF8 protein levels compared with WT mice. F4/80⁺ peritoneal macrophages in Irf8 -50^-/- mice also have greatly reduced intracellular IRF8 protein levels. These mice are more susceptible to Salmonella infection.

Of note, Irf8 +32^-/- mice are a similar strain with CRISPR/Cas9-generated deletion another Irf8 enhancer, +32 kb downstream from the transcriptional start site, and are available as Stock No. 032744.

Irf8 +41^-/- mice are a similar strain with CRISPR/Cas9-generated deletion of another Irf8 enhancer, +41 kb downstream from the transcriptional start site, and are available as Stock No. 032745.

Development

Plasmids encoding sgRNA (ggtgacatctgtctacggag and atgcacccaaggcctggctc) were designed to delete an enhancer of the interferon regulatory factor 8 (Irf8) gene located at -50 kb upstream from the transcriptional start site. These sgRNAs and the cas9 nuclease were introduced into the cytoplasm of C57BL/6J-derived fertilized eggs with well recognized pronuclei. Correctly targeted embryos were transferred to pseudopregnant females. Correctly targeted pups were identified by PCR and further bred to C57BL/6J mice to develop a colony of Irf8 -50^-/- mice. Cryopreserved sperm was sent to The Jackson Laboratory. Upon arrival, an aliquot of frozen sperm was used to fertilize C57BL/6J (Stock No. 000664) oocytes to establish our live colony.

In 2020, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the rederived living colony at The Jackson Laboratory Repository. Three of the 5 markers that determine C57BL/6J from C57BL/6N were found to be segregating, including the rd8 recessive mutation associated with retinal degeneration on Chromosome 1 within the Crb1 locus. These data suggest the mice sent to The Jackson Laboratory Repository were on a mixed C57BL/6N;C57BL/6J genetic background.