C57BL/6-Rr172^em1Kmm/J

Stock number: 032744
Product name: Irf8 +32^-
Strain synonyms: C57BL/6J-Irf8^em1Kmm/J
Research areas: Cell Biology Research, Immunology, Inflammation and Autoimmunity Research

Description

Irf8 +32^-/- mice have a CRISPR/Cas9-generated deletion of an enhancer located in the super-enhancer of the interferon regulatory factor 8 (Irf8) gene making this strain useful when studying classical type 1 dendritic cell development and fate specification from its multipotent progenitor.

Detailed description

CRISPR/cas9 endonuclease mediated genome editing of the interferon regulatory factor 8 (Irf8) gene was used to delete an enhancer located in the super-enhancer +32 kb downstream from the transcriptional start site. IRF8 encodes a transcription factor required for classical type 1 dendritic cell (cDC1) fate specification. These mice have a 421 bp deletion that eliminates all four AP1-IRF composite elements (AICEs) in the +32-kb Irf8 enhancer, resulting in complete elimination of all residual cDC1s with no defects in other lineages.

Of note, Irf8 +41^-/- mice are a similar strain with CRISPR/Cas9-generated deletion of the other Irf8 enhancer, +41 kb downstream from the transcriptional start site, and are available as Stock No. 032745.

Irf8 -50^-/- mice have a CRISPR/Cas9-generated deletion of an enhancer located 50 kb upstream of the transcriptional start site, and are available as Stock No. 032746.

Development

Plasmids encoding sgRNA (gttgtgatctttgaggtaga, gtctccttctgaaatttcagtt, and gaactggcctggggcaggtc) were designed to delete one of two enhancers located in the super-enhancer of the interferon regulatory factor 8 (Irf8) gene +32 kb downstream from the transcriptional start site. These sgRNAs and the cas9 nuclease were introduced into the cytoplasm of C57BL/6J-derived fertilized eggs with well recognized pronuclei. Correctly targeted embryos were transferred to pseudopregnant females. Correctly targeted pups were identified by PCR and further bred to C57BL/6J mice to develop a colony of Irf8 +32^-/- mice. Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J (Stock No. 000664) oocytes.

In 2020, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the rederived living colony at The Jackson Laboratory Repository. Two of the 5 markers that determine C57BL/6J from C57BL/6N were found to be segregating. These data suggest the mice sent to The Jackson Laboratory Repository were on a mixed C57BL/6N;C57BL/6J genetic background.