B6.Cg-Del(13Naip1-Naip5)1Vnce Naip2^em2Vnce/J

Stock number: 032660
Product name: Naip1-6^Δ
Research areas: Apoptosis Research, Immunology, Inflammation and Autoimmunity Research, Research Tools

Description

Naip1-6^Δ mice were created using a single guide RNA to disrupt all functional Naip genes on mouse Chromosome 13 using CRISPR/Cas9 methodology. Homozygous knock-out Naip1-6^Δ mice fail to respond to cytosolic flagellin, T3SS (type III secretion system) needle or inner rod protein.

Detailed description

NAIPs (NLR family, apoptosis inhibitory proteins) are NLRs (nucleotide-binding domain [NBD] leucine-rich repeat [LRR]-containing proteins) that appear to function as cytosolic immunoreceptors for specific bacterial proteins, including flagellin and the inner rod and needle proteins of bacterial type III secretion systems (T3SSs). Naip loci are sequentially aligned on mouse Chromosome 13: Naip1, Naip3, Naip6, Δ Naip, Naip5, and Naip2. Naip3 is considered to be a pseudogene and Δ Naip is truncated and believed non-functional.

CRISPR/Cas9 methodologies were used to create an allele/strain that is deficient for all functional Naip genes (1, 2, 5, and 6), as well as the pseudogene Naip3. Naip2 was inactivated by a 4 bp frameshift deletion (the same as found in Stock No. 032658), and the sequence between Naip5 exon 6 and Naip1 exon 6 (including the entire Naip6, Naip3, and Δ Naip loci) was deleted, leading to a nonfunctional fusion of Naip5 and Naip1. Homozygous Naip1-6^Δ mice fail to respond to cytosolic flagellin, consistent with previous biochemical data implicating Naip6 in flagellin detection. They also fail to respond to type III secretion system needle or inner rod protein.

Single knock-outs of Naip1 (which detects T3SS needle protein; see Stock No. 032657) and Naip2 (which detects T3SS inner rod protein; see Stock No. 032658) demonstrate that neither of these genes is required for detection of flagellin. A knock-out of Naip5 (see Stock No. 032659) retains some residual responsiveness to flagellin in vivo.

Development

A family of Naip loci are sequentially aligned on mouse Chromosome 13: Naip1, Naip3, Naip6, Δ Naip, Naip5, and Naip2. Naip3 is considered to be a pseudogene and Δ Naip is truncated and believed non-functional.

A single guide RNA (sgRNA; sequence GGTCAGAAGAGAATTACCTA) with protospacer adjacent motif (PAM; sequence TGG) targeted Cas9 to a 20-nucleotide sequence in exon 6 (the fourth coding exon) in each of the four functional mouse Naip genes (Naip1, 2, 5, and 6). The sgRNA and Cas9 were injected into B6(Cg)-Tyr^c-2J/J embryos.

Naip2 was inactivated by a 4 bp frameshift deletion (the same as found in Stock No. 032658) in exon 4, and the sequence between Naip5 exon 6 and Naip1 exon 6 (including the entire Naip6, Naip3, and Δ Naip loci) was deleted, leading to a nonfunctional fusion of Naip5 and Naip1.

This strain was backcrossed to C57BL/6J for four generations to remove the Tyr^c-2J albinism allele and off-target CRISPR mutations.

Allele

Symbol: Naip2^em2Vnce
Name: endonuclease-mediated mutation 2, Russell E Vance
MGI accession ID: MGI:6246533
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Marker symbol: Naip2
Marker name: NLR family, apoptosis inhibitory protein 2
Marker synonyms: BIRC1; Birc1a; Birc1b; Naip; Naip-rs6; NLRB1; psiNAIP
Chromosome: 13
Strain of origin: B6(Cg)-Tyr^c-2J/J
Molecular note: A single guide RNA (sgRNA; sequence GGTCAGAAGAGAATTACCTA) with protospacer adjacent motif (PAM; sequence TGG) targeted Cas9 to a 20-nucleotide sequence in exon 6 (the fourth coding exon) in each of the four functional mouse Naip genes (Naip1, 2, 5, and 6), resulting in a 4 bp frameshift deletion in Naip2 gene. The deletion is predicted to result in NAIP proteins truncated before the NBD (a domain essential for NAIP). The sequence between Naip5 exon 6 and Naip1 exon 6 was deleted including Naip3 and Naip6, leading to a nonfunctional fusion of Naip5 and Naip1, generating separate allele deletion, Chr 13, Russell Vance 1.

Allele

Symbol: Del(13Naip1-Naip5)1Vnce
Name: deletion, Chr 13, Russell E Vance 1
MGI accession ID: MGI:6246513
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Marker symbol: Del(13Naip1-Naip5)1Vnce
Marker name: deletion, Chr 13, Russell Vance 1
Chromosome: 13
Strain of origin: B6(Cg)-Tyr^c-2J/J
Molecular note: A single guide RNA (sgRNA; sequence GGTCAGAAGAGAATTACCTA) with protospacer adjacent motif (PAM; sequence TGG) targeted Cas9 to a 20-nucleotide sequence in exon 6 (the fourth coding exon) in each of the four functional mouse Naip genes (Naip1, 2, 5, and 6). The sequence between Naip5 exon 6 and Naip1 exon 6 was deleted including Naip3 and Naip6, leading to a nonfunctional fusion of Naip5 and Naip1. It also resulted in a 4 bp frameshift deletion in Naip2 gene Naip2^em2Vnce.