NOD.Cg-Prkdc^scid Abcd1^em2Lutzy Il2rg^tm1Wjl Tg(CMV-IL3,CSF2,KITLG)1Eav/MloySzJ

Stock number: 032474
Product name: NSG-SGM3-Abcd1^Δ897
Research areas: Cancer Research, Immunology, Inflammation and Autoimmunity Research, Internal/Organ Research, Research Tools, Virology Research

Description

NSG-SGM3-Abcd1^Δ897 mice (also called NSGS-Abcd1^Δ897) are NOD.scid.Il2Rγc^null ("NSG") animals with the SGM3 transgenes expressing human IL3, GM-CSF and SCF and the Abcd1^Δ897 frameshift deletion mutation.
The triple transgenic NSG-SGM3 (NSGS) mice expressing human IL3, GM-CSF (CSF2) and SCF (KITLG) combine the features of the highly immunodeficient NOD scid gamma (NSG) mouse with cytokines that support the stable engraftment of myeloid lineages and regulatory T cell populations. NSG-SGM3 mice allow superior engraftment of diverse hematopoietic lineages and primary AML samples than other models and are useful for immuno-oncology, immunology and infectious disease studies. Mutations in Abcd1 have been associated with adrenoleukodystrophy.

Detailed description

NSG-SGM3-Abcd1^Δ897 mice (also called NSGS-Abcd1^Δ897) are NOD.scid.Il2Rγc^null ("NSG") animals with the SGM3 transgenes expressing human IL3, GM-CSF and SCF and the Abcd1^Δ897 frameshift deletion mutation.

Females homozygous for scid (Prkdc^scid), homozygous for the X-linked Abcd1^Δ897 (Abcd1^em2Lutzy), homozygous for the X-linked Il2Rγc^null (Il2rg^tm1Wjl) and homozygous for the SGM3 transgenes (Tg(CMV-IL3,CSF2,KITLG)1Eav), and males that are homozygous for scid, hemizygous for the X-linked Abcd1^Δ897, hemizygous for the X-linked Il2Rγc^null and homozygous for the SGM3 transgenes may be collectively referred to as homozygous NSG-SGM3-Abcd1^Δ897 mice.

Homozygous NSG-SGM3-Abcd1^Δ897 mice in The Jackson Laboratory Repository colony are viable and fertile. As the mice are characterized, we may modify the strain description accordingly.

Homozygous NSG-SGM3-Abcd1^Δ897 mice may be expected to combine the NSG-SGM3 phenotype (Stock No. 013062) with that of ABCD1 deficiency, each is described below.
The triple transgenic NSG-SGM3 (NSGS) mice expressing human IL3, GM-CSF and SCF combine the features of the highly immunodeficient NSG mouse with cytokines that support the stable engraftment of myeloid lineages and regulatory T cell populations. NSG-SGM3 mice allow superior engraftment of diverse hematopoietic lineages and primary AML samples than other models and are useful for immuno-oncology, immunology and infectious disease studies.
The targeted ATP-binding cassette, sub-family D (ALD), member 1 gene (Abcd1) encodes a peroxisomal ATP-binding cassette (ABC) transporter. Mutations in this gene have been associated with adrenoleukodystrophy. Other mice homozygous/hemizygous for disruptions in this gene develop a late onset of neurodegenerative disease (no neurological symptoms up to 6 months of age), with an accumulation of very long chain fatty acids.

Similar to other immunodeficient strains, maintaining homozygous NSG-SGM3-Abcd1^Δ897 mice in high health status (specific pathogen-free) vivaria promotes overall colony health. If homozygous NSG-SGM3-Abcd1^Δ897 animals are maintained in low health barrier rooms, the use of medicated water (e.g., sulfatrim/trimethoprim-sulfa or enrofloxacin/Baytril) is suggested to increase overall colony health.

View our Resources for the NSG mouse model, including discussion forum, immunodeficient model comparison, and categorized, up-to-date references.

Development

NSG-SGM3-Abcd1^Δ897 mice are NOD.scid.Il2Rγc^null ("NSG") animals with the SGM3 transgenes expressing human IL3, GM-CSF and SCF and the Abcd1^Δ897 frameshift deletion mutation. NSG-SGM3-Abcd1^Δ897 mice harbor several mutations, as described below.

NSG mice are non-obese diabetic animals (NOD/ShiLtJ) harboring the spontaneous severe combined immunodeficiency mutation (Prkdc^scid) on chromosome 16 and the Il2Rγc^null mutation at ~101 Mbp on the X chromosome (Il2rg^tm1Wjl created by Dr. Warren J. Leonard [NIH]). NSG mice are described and available from The Jackson Laboratory Repository as Stock No. 005557.

NSG-SGM3 mice are NSG animals also harboring three transgenes (Tg(CMV-IL3,CSF2,KITLG)1Eav) composed of the human interleukin-3 (IL-3) gene, the human granulocyte/macrophage-stimulating factor (GM-CSF) gene and human Steel factor (SF) gene. Expression of each human gene is driven by a human cytomegalovirus promoter/enhancer sequence, and is followed by a human growth hormone cassette and a polyadenylation (polyA) sequence. NSG-SGM3 mice are described and available from The Jackson Laboratory Repository as Stock No. 013062.

The Abcd1^Δ897 allele (Abcd1^em2Lutzy) was created at The Jackson Laboratory using CRISPR/Cas9 genome engineering in NSG-SGM3 mouse zygotes (from Stock No. 013062). Four oligo nucleotide guides RNAs (ACAAAATCTACCCTCTAGTA, GTCAGACACTGCCGTACTAG, TAAAGTTGTAGATAGACACT and AGACACTGGGACAAGCTTGG) were designed to introduce a large frameshift deletion mutation spanning exon 1/intron 1 of the ATP-binding cassette, sub-family D (ALD), member 1 locus (Abcd1) on chromosome X [~73.7 Mbp]. DNA sequencing of the offspring identified the allele to be a 897 nt frameshift deletion that begins 103 nt 3' of the ATG translation start codon in exon 1 and extends 100 nt into intron 1. Correctly targeted founder progeny were bred twice to NSG-SGM3 (Stock No. 013062), and thereafter bred together to develop and maintain the mutant colony. This colony may be maintained by breeding females homozygous for scid, heterozygous or homozygous for Abcd1^Δ897, homozygous for Il2Rγc^null and homozygous for the SGM3 transgenes with males homozygous for scid, heterozygous or hemizygous for Abcd1^Δ897, hemizygous for Il2Rγc^null and hemizygous for the SGM3 transgenes.

Allele

Symbol: Tg(CMV-IL3,CSF2,KITLG)1Eav
Name: transgene insertion 1, CJ Eaves
MGI accession ID: MGI:3653745
Generation method: Transgenic
Attributes: Inserted expressed sequence; Humanized sequence
Synonyms: 3/GM/SF; SGM3; Tg(hSCF/hGM-CSF/hIL3
Marker symbol: Tg(CMV-IL3,CSF2,KITLG)1Eav
Marker name: transgene insertion 1, CJ Eaves
Marker synonyms: 3/GM/SF
Chromosome: UN
Strain of origin: (C57BL/6 x C3H/HeN)F1
Expressed genes: IL3,interleukin 3,human; CSF2,colony stimulating factor 2,human; KITLG,KIT ligand,human
Molecular note: cDNAs encoding human interleukin 3, colony stimulating factor 2 (granulocyte-macrophage) and kit ligand were independently ligated into expression cassettes in which the cDNA resides downstream of the cytomegalovirus (CMV) promoter/enhancer sequence and is followed by human growth factor intronic and polyadenylation sequences. A transgenic mouse that was shown by ELISA to have serum levels of all three growth factors at ng/ml levels was used to establish a line with the same phenotype.

Allele

Symbol: Abcd1^em2Lutzy
Name: endonuclease-mediated mutation 2, Cathy Lutz
MGI accession ID: MGI:6392813
Generation method: Endonuclease-mediated
Attributes: Not Specified
Synonyms: Abcd1^delta897
Marker symbol: Abcd1
Marker name: ATP-binding cassette, sub-family D (ALD), member 1
Marker synonyms: ABC42; ALD; Aldgh; ALDP; AMN; RGD1562128
Chromosome: X
Strain of origin: NOD.Cg-Prkdc^scid Il2rg^tm1Wjl Tg(CMV-IL3,CSF2,KITLG)1Eav/MloySzJ
Molecular note: Four oligo nucleotide guides RNAs (ACAAAATCTACCCTCTAGTA, GTCAGACACTGCCGTACTAG, TAAAGTTGTAGATAGACACT and AGACACTGGGACAAGCTTGG) were designed to introduce a large frameshift deletion mutation spanning exon 1/intron 1 of the gene using CRISPR/Cas9 genome editing. DNA sequencing of the offspring identified the allele to be a 897 nt frameshift deletion that begins 103 nt 3' of the ATG translation start codon in exon 1 and extends 100 nt into intron 1.

Allele

Symbol: Prkdc^scid
Name: severe combined immunodeficiency
MGI accession ID: MGI:1857113
Generation method: Spontaneous
Synonyms: scid
Marker symbol: Prkdc
Marker name: protein kinase, DNA activated, catalytic polypeptide
Marker synonyms: DNAPDcs; DNAPK; DNA-PK; DNAPKc; DNA-PKC; DNA-PKcs; DNPK1; DOXNPH; dxnph; HYRC; HYRC1; IMD26; p350; S473K; slip; XRCC7
Chromosome: 16
Strain of origin: C.BKa-Igh^b/Icr
Site of expression: T and B lymphocytes.
Molecular note: A T-to-A transversion point mutation at a position corresponding to codon 4046 (codon 4095 in transcript ENSMUST00000023352.8) created a premature stop codon (p.Y4046*).

Allele

Symbol: Il2rg^tm1Wjl
Name: targeted mutation 1, Warren J Leonard
MGI accession ID: MGI:1857455
Generation method: Targeted
Attributes: Null/Knockout
Synonyms: [KO]gammac; CD132^-; gammac^-; gc^-; Il2rg^tm1Wjll; IL2Rgamma^null
Marker symbol: Il2rg
Marker name: interleukin 2 receptor, gamma chain
Marker synonyms: [g]c; Ab2-183; Cd132; CIDX; common cytokine receptor gamma chain; common gamma chain; gamma C receptor; gamma(c); gammaC; gc; IL-2RG; IMD4; P64; SCIDX; SCIDX1
Chromosome: X
Strain of origin: 129S4/SvJae
Site of expression: Primarily lymphoid cells.
Molecular note: A neomycin resistance cassette replaced part of exon 3 and all of exons 4 - 8 of the gene, resulting in the loss of most of the extracellular domain and all of the transmembrane and cytoplasmic domains of the protein.