B6(129X1)-Dst^em13Dcr/DcrJ

Stock number: 032425
Research areas: Dermatology Research, Immunology, Inflammation and Autoimmunity Research

Description

This CRISPR/Cas9 generated mutant of the dystonin gene (Dst) carries a 1016 bp deletion in epidermis-specific isoform Dst-e exon 23. These mice may be useful in studies related to epidermolysis bullosa simplex without dystonia musculorum.

Detailed description

CRISPR/cas9 endonuclease-mediated genome editing of the dystonin gene (Dst) was used to introduce a 1016 bp deletion in exon 23, which is specific for the epidermis isoform Dst-e. The targeted Dst gene encodes an adhesion junction plaque protein. Mutations in this gene have been associated with autosomal recessive epidermolysis bullosa simplex-2. Beginning at 8 weeks of age, homozygotes exhibit trunk hair loss, followed by skin blistering beginning at 12 weeks of age. By 30-35 weeks of age, small regions of dermal-epidermal separation are noticeable in ear and tail skin by light microscopy. Electron microscopy analysis of skin dorsal trunk skin reveals that homozygotes lack hemidesmosomal inner plaques. While homozygotes are viable and fertile, the onset of the hair loss and skin lesion phenotype is at approximately 8 weeks of age, therefore the mice are maintained as heterozygotes.

The phenotype of mice homozygous for Dst^em13Dcr (Stock No. 032425) is more severe than the phenotype of mice homozygous for Dst^em14Dcr (Stock No. 032426).

When crossed to B6.129X1-Lamc2^jeb/Dcr mice (Stock Nos. 025635 or 025467) the resulting double mutant mice exhibit an acceleration of the epidermolysis bullosa phenotype and may be useful for studying internal disease symptoms associated with epidermolysis bullosa.

Development

cas9 nuclease mRNA, single guide RNA GCGGAAGCTCGGCGAGCCGCGG (PAM underlined), and a 200mer single-stranded DNA oligo designed for amino acid replacement were introduced into the cytoplasm C57BL/6J-derived fertilized eggs. Correctly targeted embryos were transferred to pseudopregnant females. The Dst^em13Dcr allele consists of a 1016 bp deletion in the epidermis-specific isoform Dst-e exon 23 (Ensembl Dst-213). Correctly targeted pups were identified by sequencing and PCR and further bred to C57BL/6J inbred mice (Stock No. 000664) to develop the colony. The mice were crossed to B6.129X1-Lamc2^jeb/Dcr (Stock No. 025635). The mice were then bred to C57BL/6J to breed out the Lamc2^jeb allele. Heterozygotes were intercrossed to generate homozygotes. Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. 000664).

Allele

Symbol: Dst^em13Dcr
Name: endonuclease-mediated mutation 13, Derry C Roopenian
MGI accession ID: MGI:6258920
Generation method: Endonuclease-mediated
Attributes: Modified isoform(s)
Marker symbol: Dst
Marker name: dystonin
Marker synonyms: 2310001O04Rik; A830042E19Rik; ah; athetoid; BP240; BPA; Bpag; Bpag1; BPAG1-n; bullous pemphigoid antigen 1; CATX15; CATX-15; CMYO29; D6S1101; DMH; DT; EBS3; EBSB2; HSAN6; LCCS12; Macf2; mKIAA0728; nmf203; nmf339
Chromosome: 1
Strain of origin: C57BL/6J
Molecular note: CRISPR/cas9 endonuclease mediated genome editing is used to introduce a 1016 bp deletion in exon 23, which is specific for the epidermis isoform Dst-e. and causes a frame-shift