C57BL/6J-Sptlc1^em2Rwb/J

Stock number: 032194
Product name: Sptlc1^C133W
Research areas: Developmental Biology Research, Neurobiology Research, Research Tools

Description

Sptlc1^C133W knock-in mice carry a cysteine to tryptophan substitution at position 133 of the serine palmitoyltransferase, long chain base subunit 1 gene. Mice exhibit increased levels of 1-deoxysphingolipids, and some behavioral defects, but do not develop a neuropathy phenotype. These mice may be useful for research involving hereditary sensory and autonomic, neuropathy type I (HSAN1).

Detailed description

Sptlc1 (serine palmitoyltransferase, long chain base subunit 1) encodes a subunit of serine palmitoyltransferase. Serine palmitoyltransferase is a key enzyme in sphingolipid biosynthesis; it functions by conjugating palmitoyl-CoA and L-Serine to form a long chain base. The C133W mutation has been identified in patients with hereditary sensory and autonomic, neuropathy type I (HSAN1).

Sptlc1^C133W knock-in mice carry a cysteine to tryptophan substitution at position 133 (C133W) and well as a silent mutation at position 132 (T132T). Mice heterozygous for the mutation are viable and fertile. Heterozygote x heterozygote crosses do not appear to produce homozygous progeny. The mutation appears to cause homozygous embryonic or perinatal lethality. Sptlc1^C133W heterozygous mice produce the same levels of SPTLC1 protein as wild type as assessed by western blot. Heterozygous mice exhibit increased levels of the metabolites 1-deoxy- and 1-deoxymethyl-sphinganine produced by the conjugation of glycine or alanine in addition to serine. Behavioral testing of heterozygotes identified a decreased thermal sensitivity (hot plate test) in males (but not females), and a shorter latency to fall in the rotarod test in females (but not males). Axon degeneration is not observed in the peripheral nerves of Sptlc1^C133W mice, although there is small decrease in femoral sensory axon caliber.

Development

CRISPR/cas9 endonuclease-mediated genome editing was used to create a cysteine to tryptophan substitution at position 133 (C133W, TGT to TGG) and a silent C to G mutation in codon 132 (T132T) in exon 5 of the Sptlc locus on chromosome 13. The silent mutation eliminates the PAM site and prevents recutting with Cas9. Single guide RNA (AAGTACGGAGTGGGTACCTG), cas9 endonuclease and single stranded donor oligos were introduced into C57BL/6J-derived fertilized eggs by pronuclear injection. Embryos were transferred to pseudopregnant females, and correctly targeted pups were bred to C57BL/6J mice for germline transmission. The colony was crossed to C57BL/6J for more than 3 generations. Upon arrival, mice were bred to C57BL/6J (Stock No. 000664) for at least one generation to establish the colony.

Allele

Symbol: Sptlc1^em2Rwb
Name: endonuclease-mediated mutation 2, Robert W Burgess
MGI accession ID: MGI:7427573
Generation method: Endonuclease-mediated
Attributes: Humanized sequence
Synonyms: Sptlc1^C133W
Marker symbol: Sptlc1
Marker name: serine palmitoyltransferase, long chain base subunit 1
Marker synonyms: ALS27; HSAN1; HSN1; LBC1; LCB 1; LCB1; RGD1306617; SPT 1; Spt1; SPTI
Chromosome: 13
Strain of origin: C57BL/6J
Molecular note: CRISPR/cas9 endonuclease-mediated genome editing is used to create an cysteine to tryptophan substitution at position 133 (C133W, TGT to TGG) and a silent C to G mutation in codon 132 (T132T) in exon 5. The silent mutation eliminates the PAM site and prevents recutting with Cas9.