STOCK Ca11^em1Sud Ca10^em1Sud/J

Stock number: 031998
Product name: CA10/11 cKO
Research areas: Neurobiology Research

Description

These CRISPR/Cas9-generated mice carry targeted knock-outs of both the mouse Car10 and Car11 genes that encode ligands of Nrxn1 (neurexin 1), a cell adhesion molecule in the brain.

Detailed description

Car10 (carbonic anhydrase 10; on mouse Chromosome 11) and Car 11 (carbonic anhydrase 11; on mouse Chromosome 7) encode proteins that were recently identified as novel ligands for Nrxn1 (neurexin 1), a cell adhesion molecule in the brain.

These CRISPR/Cas9-generated mice carry targeted knock-outs of both the mouse Car10 and Car11 genes, as determined by Western blot. Mice homozygous for both mutations are viable and fertile and have no overt phenotype.

Development

CRISPR/Cas9 methodologies were used to delete 61 bp of mouse gene Car10 (including the last 32 bp of exon 2) and delete 40 bp from exon 2 of the mouse Car11 gene.

The guide RNA (gRNA) sequences for the Car10 mutation were: TGAAGGCTGGTGGGCATACAAGG and CCAGGGAAGCTTTGTTCCAGGTA. The exon 2 sequence deletion involves chr11:93185125-93185185.

Two sets of gRNAs were used to ensure the production of a Car11 mutation: exon1 - CCTGAGCGCCCCTCAAGCGCTGG and CACTGGGAGCGGCAGGTAAG, and exon 2 - GCTCTCTTCCCAGCTCACATCGG and CCGAGGACTGGTGGAGCTACAAG. A 40 bp deletion in exon 2 was produced - chr7:45700427-45700466.

The mutations were created in B6SJLF1/J hybrid embryos. Resultant mice were outcrossed to CD1 outbred mice for the first generation and then intercrossed. This strain was maintained on a mixed C57BL/6, SJL, and CD1 genetic background by the donating laboratory.

Allele

Symbol: Ca10^em1Sud
Name: endonuclease-mediated mutation 1, Thomas C Sudhof
MGI accession ID: MGI:6157349
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Marker symbol: Ca10
Marker name: carbonic anhydrase 10
Marker synonyms: 2700029L05Rik; Car10; CA-RP X; CARPX; CA-RPX; HUCEP-15
Chromosome: 11
Strain of origin: (C57BL/6J x SJL/J)F1/J
Molecular note: CRISPR/Cas9 methodologies were used to delete 61 bp of mouse gene Car10 (including the last 32 bp of exon 2). The guide RNA (gRNA) sequences for the Car10 mutation were: TGAAGGCTGGTGGGCATACAAGG and CCAGGGAAGCTTTGTTCCAGGTA. The exon 2 sequence deletion involves chr11:93185125-93185185.

Allele

Symbol: Ca11^em1Sud
Name: endonuclease-mediated mutation 1, Thomas C Sudhof
MGI accession ID: MGI:6157348
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Marker symbol: Ca11
Marker name: carbonic anhydrase 11
Marker synonyms: Car11; CA-RP; CA-RP II; CA-RP XI; CARP-2; CARPX1; CAR-XI; CA-XI
Chromosome: 7
Strain of origin: (C57BL/6J x SJL/J)F1/J
Molecular note: CRISPR/Cas9 methodologies were used to delete 40 bp from exon 2 of the mouse Car11 gene. Two sets of gRNAs were used to ensure the production of a Car11 mutation: exon1 - CCTGAGCGCCCCTCAAGCGCTGG and CACTGGGAGCGGCAGGTAAG, and exon 2 - GCTCTCTTCCCAGCTCACATCGG and CCGAGGACTGGTGGAGCTACAAG. A 40 bp deletion in exon 2 was produced - chr7:45700427-45700466.