NOD/ShiLt-H2-K1^d-em1Dvs H2-D1^b-em5Dvs/J

Stock number: 031855
Product name: NOD-cMHCI^-/-
Strain synonyms: NOD-H2-K^- H2-D^-, NOD-cMHCI<->
Research areas: Diabetes and Obesity Research, Immunology, Inflammation and Autoimmunity Research, Research Tools

Description

This CRISPR/Cas9 generated mutant of the H2-K1 and H2-D1 genes (cMHCI^-/-) carries knock-out mutations in both classical MHC Class I genes. This strain is one of a series of mice used to develop HLA-humanized NOD models for use in T1D therapy development.

Detailed description

Development of Type 1 diabetes (T1D) is associated with specific major histocompatibility Class I and Class II variants in both humans and mouse. In the mouse, the presence of the H2-A^g7 class II variant (homolog of DQ8 in humans) is a primary contributor to development of T1D. Susceptibility to T1D is also influenced by the expression of several class I variants in humans including HLA-A2 (Tg(HLA-A/H2-D/B2M)1Dvs) and HLA-B39 (Tg(HLA-B39/H2-D/B2m)2Dvs). Elimination of mouse MHC Class I expression initially was accomplished by targeted ablation of the β 2m gene, however, this deletion also ablates non-classical MHC molecules including CD1d, Qa-2 and FcRn. Subsequently, NOD-cMHCI^-/- mice were created using CRISPR/Cas9 technology to delete sequence in both classical MHC class I genes, H2-D1 and H2-K1. These mice do not express H2-D1^b or H2-K1^d, but do express the non-classical MHC Ib molecules. Mice homozygous for both null alleles exhibit a substantial decrease in splenic CD8+ T cells, increased CD4+ T cells and resistance to T1D and insulitis out to 30 weeks of age.

This strain is one of a series of mice that can be used to develop HLA-humanized NOD models for use in T1D therapy development.

Development

The H2-K^-/- and H2-D^-/- alleles (cMHCI^-/-) were created by Dr. David Serreze (The Jackson Laboratory) using CRISPR/cas9 endonuclease-mediated genome editing in NOD/ ShiLtDvs mouse zygotes.

Specifically, guide RNA was designed to delete a single nucleotide in exon 2 of the H2-K1 gene and two deletions (11 bp and 3 bp) in exon 2 of the H2-D1 gene.

The sgRNA and Cas9 endonuclease were introduced into NOD/ShiLtDvs-derived fertilized eggs by pronuclear injection. Embryos were transferred to pseudopregnant females, and correctly targeted pups (identified by sequencing) were bred to NOD/ShiLtDvs inbred mice for germline transmission. Null phenotypes were confirmed by flow cytometry. The colony was maintained on NOD/ShiLtDvs and was bred to NOD/ShiLtJ (Stock 001976) for at least 1 generation to establish the colony in the Repository.

Allele

Symbol: H2-K1^d-em1Dvs
Name: endonuclease-mediated mutation 1, David V Serreze
MGI accession ID: MGI:6119459
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Synonyms: H2-K1^em1Dvs
Marker symbol: H2-K1
Marker name: histocompatibility 2, K1, K region
Marker synonyms: AS; B-4901; CDA12; D6S204; H-2K; HLA-5.4; HLA-6.2; HLAA; HLAB; HLAC; HLA-CDA12; HLAF; HLAHP; HLA-JY3; HLC-C; MHC; MHC-G; PSORS1; QA1; RT1.A2(N); RT1.Cg; RT1A-2; RT1-A2n; RT1-C/E1; RT1-C/E2; RT1-CE12; RT1-Uav1; RT1-Uc; RT1-Ulv1
Chromosome: 17
Strain of origin: NOD/ShiLtDvs
Molecular note: This single nucleotide (G) deletion within exon 2 was shown by flow cytometry to cause a null allele. it was generated by injection of Cas9 and guide sequences GTACATCTCTGTCGGCTATG targeting H2-D1^b and ATAATCCGAGATTTGAGCCG targeting H2-K1^d into NOD/ShiLtDvs embryos, which resulted in this point deletion and the intragenic deletions of H2-D1^em5Dvs.

Allele

Symbol: H2-D1^b-em5Dvs
Name: endonuclease-mediated mutation 5, David V Serreze
MGI accession ID: MGI:6119467
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Marker symbol: H2-D1
Marker name: histocompatibility 2, D region locus 1
Marker synonyms: AS; B-4901; CDA12; D6S204; H-2D; HLA-5.4; HLA-6.2; HLAA; HLAB; HLAC; HLA-CDA12; HLAF; HLAHP; HLA-JY3; HLC-C; MHC; MHC-G; PSORS1; QA1; RT1.A2(N); RT1.Cg; RT1A-2; RT1-A2n; RT1-C/E1; RT1-C/E2; RT1-CE12; RT1-Uav1; RT1-Uc; RT1-Ulv1
Chromosome: 17
Strain of origin: NOD/ShiLtDvs
Molecular note: Cas9 and guide sequences GTACATCTCTGTCGGCTATG targeting H2-D1^b and ATAATCCGAGATTTGAGCCG targeting H2-K1^d were injected into NOD/ShiLtDvs embryos resulting in two deletions in exon 2, one 11 bp and one 3 bp, in addition to the single nucleotide deletion that is H2-K1^em1Dvs.