B6J.129-Pex5^tm1Pec/BaesJ

Stock number: 031665
Product name: B6J.Pex5^2loxP , B6J.Pex5-loxP , B6J.Pex5^FL
Research areas: Cell Biology Research, Developmental Biology Research, Internal/Organ Research, Metabolism Research, Neurobiology Research, Research Tools

Description

Pex5^2loxP (Pex5-loxP , Pex5^FL) mice have loxP sites flanking exons 11-14 (the four exons encoding several tetratricopeptide repeat domains that are essential for PEX5 function). See the Detailed Description section for additional information regarding the number of loxP sites.
Deletion of the floxed sequences creates a null allele. These Pex5^2loxP mice are useful for studying the absence of functional peroxisomes in selective organs and at different stages of life, and are a model for studying characteristics of Zellweger Spectrum Disorder (ZSD).
Pex5^2loxP mice are available on a C57BL/6J genetic background (B6J.Pex5^2loxP; Stock No. 031665) and on a Swiss outbred background (SWISS.Pex5^2loxP; Stock No. 031666).

Detailed description

PEX5 (peroxisomal biogenesis factor 5) is an essential component of the peroxisomal protein import machinery.

The Pex5^2loxP (Pex5-loxP , Pex5^FL) floxed allele has loxP sites flanking exons 11-14 (the four exons encoding several tetratricopeptide repeat domains that are essential for Pex5p function). See additional information below regarding the number of loxP sites.

In the absence of Cre recombinase, mice homozygous for the floxed allele (Pex5^2loxP/2loxP) are viable and fertile with normal fertility and peroxisomal metabolism, and no gross phenotypic or behavioral abnormalities.

Exposure to Cre recombinase results in a PEX5 knock-out allele.
For example, when bred to Nestin-Cre mice (Tg(Nes-cre)1Kln; see Stock No. 003771), deletion of the floxed four exons resulted in a shorter Pex5 mRNA - from which no immunoreactive PEX5 protein was created. The resulting Pex5^2loxP/2loxP;NesCre^+/- mice are useful to test PEX5 inactivation in brain. [Baes et al. 2002 Genesis 32:177 (PMID:11857813)]

Pex5^2loxP mice are available on a C57BL/6J genetic background (B6J.Pex5^2loxP; Stock No. 031665) and on a Swiss outbred background (SWISS.Pex5^2loxP; Stock No. 031666).

Additional information on loxP sites:
In 2021, sequencing analysis performed by The Jackson Laboratory revealed that the loxP site in intron 14 is in fact two loxP sites in the same orientation/direction that flank a 12 bp sequence [ATAACTTCGTATAATGTATGCTATACGAAGTTAT::CCCGGGTGTACT::ATAACTTCGTATAATGTATGCTATACGAAGTTAT]. As such, the Pex5 floxed allele appears to have three loxP sites (loxP::exons 11-14::loxP::12bp::loxP). Importantly, recombination between the two intron 14 loxP sites is highly unlikely to occur, as Cre recombination is reported to be highly inefficient below a minimum distance of ~82 bp [Weber et al. 2016, Poulin et al. 2011, Hoess et al. 1985]. Significantly more likely scenarios are recombination between the intron 10 loxP site and either one of the intron 14 loxP sites - both of which would result in deletion of exons 11-14 and leave a single loxP remaining or a loxP::12bp::loxP remaining.
Of note, the sequence characterized in this analysis was confined to a 300 bp region downstream of exon 14, therefore the presence of the intron 10 loxP site was not specifically analyzed during this investigation.

Development

The Pex5^2loxP (Pex5-loxP , Pex5^FL) allele was designed by Dr. Myriam Baes (Katholieke Universiteit Leuven [KU Leuven] - University of Leuven) to have loxP sites flanking exons 11-14 (the four exons encoding several tetratricopeptide repeat domains that are essential for Pex5p function) of the peroxisomal biogenesis factor 5 locus (Pex5) on chromosome 6. Specifically, the targeting vector was designed to have a loxP-flanked neo/tk selection cassette upstream of exon 11, and a third loxP site downstream of exon 14. The targeting vector was electroporated into (129X1/SvJ x 129S1/Sv)F1-Kitl⁺-derived R1 embryonic stem cells. Next, transient transfection with a Cre recombinase-expressing plasmid excised the floxed neo/tk selection cassette but left loxP sites flanking exons 11-14 (Pex5^2loxP). Diploid aggregations of the Pex5^2loxP ES cells with morulae (Tac:[Sw]fBR strain) yielded one chimera that transmitted the Pex5^2loxP allele to the offspring.
The donating investigator reports that some Pex5^2loxP mice were then backcrossed several generations onto C57BL/6J. The resulting animals (black coat color) were sent to The Jackson Laboratory in 2018. Upon arrival, the mice were bred to C57BL/6J inbred mice (Stock No. 000664) for several more generations to establish the C57BL/6J-congenic strain (B6J.Pex5^2loxP) as Stock No. 031665.
Of note, at least once during backcrossing, a Pex5^2loxP female was bred to a C57BL/6J inbred male (thus the Y chromosome of the congenic strain is of C57BL/6J origin).

Additional information on loxP sites:
In 2021, sequencing analysis performed by The Jackson Laboratory revealed that the loxP site in intron 14 is in fact two loxP sites in the same orientation/direction that flank a 12 bp sequence [ATAACTTCGTATAATGTATGCTATACGAAGTTAT::CCCGGGTGTACT::ATAACTTCGTATAATGTATGCTATACGAAGTTAT]. As such, the Pex5 floxed allele appears to have three loxP sites (loxP::exons 11-14::loxP::12bp::loxP). Importantly, recombination between the two intron 14 loxP sites is highly unlikely to occur, as Cre recombination is reported to be highly inefficient below a minimum distance of ~82 bp [Weber et al. 2016, Poulin et al. 2011, Hoess et al. 1985]. Significantly more likely scenarios are recombination between the intron 10 loxP site and either one of the intron 14 loxP sites - both of which would result in deletion of exons 11-14 and leave a single loxP remaining or a loxP::12bp::loxP remaining.
Of note, the sequence characterized in this analysis was confined to a 300 bp region downstream of exon 14, therefore the presence of the intron 10 loxP site was not specifically analyzed during this investigation.

Allele

Symbol: Pex5^tm1Pec
Name: targeted mutation 1, Peter Carmeliet
MGI accession ID: MGI:2384516
Generation method: Targeted
Attributes: Conditional ready (e.g. floxed); No functional change
Synonyms: Pex5^2loxP; Pex5^FL; Pex5^flox
Marker symbol: Pex5
Marker name: peroxisomal biogenesis factor 5
Marker synonyms: ESTM1; PBD2A; PBD2B; peroxisome biogenesis factor 5; PTS1-BP; PTS1R; PXR1; RCDP5
Chromosome: 6
Strain of origin: (129X1/SvJ x 129S1/Sv)F1-Kitl⁺
Molecular note: Four exons encompassing sequence encoding several tetratricopeptide repeat domains were flanked by an upstream floxed neo cassette and a downstream intronic loxP site. Transient transfection of ES cells with plasmids expressing cre resulted in the excision of the floxed neo cassette, leaving single loxP sites in the introns surrounding the four exons.