C57BL/6J-Fxn^em8Lutzy/J

Stock number: 030822
Product name: Fxn^G127V
Research areas: Cell Biology Research, Neurobiology Research

Description

Fxn^G127V mice harbor a CRISPR/Cas9-generated G127V knock-in mutation in exon 4 of the Fxn gene, this corresponds to the human G130V missense mutation which is associated with a mild form of clinical Friedreich's Ataxia (FA). These mice may be useful in preclinical studies of mitochondrial function and non-repeat expansion forms of FA.

Our preclinical efficacy testing services offer scientific expertise and an array of target-based and phenotype-based outcome measures, both in vivo and at endpoint, for flexible study designs and assay development in mouse models of Friedreich's Ataxia. See our full service platform.

Detailed description

The mitochondrial frataxin protein, encoded by Fxn, is involved in mitochondrial iron transport and respiration regulation. Mutations in this gene have been associated with Friedreich's Ataxia (FA).

To create the Fxn^G127V allele, CRISPR/Cas9 endonuclease-mediated genome editing of Fxn exon 4 was used to introduce a G>T (c.401G>T) point mutation that results in a glycine to valine amino acid substitution at residue 127 (G127V) as well as a silent nucleotide change that generated a Zral restriction site (D126D). The G127V mutation corresponds to the human G130V missense mutation associated with FA. Homozygous Fxn^G127V mouse embryonic fibroblasts (MEFs) exhibit a significant reduction in proliferation, increased cell senescence as well as increased frequency of mitochondrial DNA lesions and fragmentation. (Fil et al. 2020 Dis Model Mech.).

Heterozygous mice are viable and fertile. While homozygous mice are viable, there is significant pre-wean loss with less than 10% of Fxn^G127V homozygotes surviving to weaning.

Development

The Fxn^G127V allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing at The Jackson Laboratory. Guide RNA [TGCCACCTGACCCCCTAGGA] was selected to target exon 4 of the frataxin locus (Fxn) on Chromosome 19. Donor DNAs [AGAAGACAGCCAGATTTGCTTGTTTGGGGTCTGCTTGTTGATCACGTAGGTCCCTAGATCCCCGCCCAGCTTAATGGTGAGCACGACGTCCTAGGGGGTCAGGTGGCAGGAAGTGTGAAAAAATAGATTAGTTAG] were created encoding an G127V mutation (GGC>GTC) and a D126D silent mutation (GAT>GAC) that generated a Zral restriction site. Fxn transcript Fxn-201 was used as reference for the exon numbering and the guide/donor sequences. These sequences and Cas9 nuclease were introduced into C57BL/6J zygotes and transferred to pseudopregnant females. Progeny were screened by DNA sequencing of the targeted region and founder 262 harboring the Fxn^G127V allele was identified; this founder was then bred to C57BL/6J mice (Stock No. 000664) for germline transmission. The Fxn^G127V colony was backcrossed to C57BL/6J for a total of at least two generations.

Allele

Symbol: Fxn^em8Lutzy
Name: endonuclease-mediated mutation 8, Cathy Lutz
MGI accession ID: MGI:7616951
Generation method: Endonuclease-mediated
Attributes: Humanized sequence
Synonyms: Fxn^G127V
Marker symbol: Fxn
Marker name: frataxin
Marker synonyms: CyaY; FA; FARR; FRDA; RGD1565754; X25
Chromosome: 19
Strain of origin: C57BL/6J
Molecular note: Glycine codon 127 (GGC) in exon 4 was changed to valine (GTC) (c.380G>T:p.G127V) using an sgRNA (equivalent to TGCCACCTGACCCCCTAGGA) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the c.389G>T:p.G130V human mutation associated with Friedreich ataxia (FRDA). Transcription from this allele is normal, but translation is at about 5% of normal.