NOD.Cg-Prkdc^scid Cybb^em1Hmal Il2rg^tm1Wjl/HmalJ

Stock number: 030610
Product name: NSG.Cybb[KO] , X-CGD NSG
Research areas: Cancer Research, Cardiovascular Research, Developmental Biology Research, Hematological Research, Immunology, Inflammation and Autoimmunity Research, Internal/Organ Research, Research Tools, Virology Research

Description

NSG.Cybb[KO] mice are NOD.scid.Il2Rγc^null ("NSG") animals with a Cybb knock-out allele. They are permissive for xenograft/human tumor growth with CYBB-deficiency resulting in defective phagocyte function. This phagocyte-defective X-CGD NSG mouse model allows in vivo assessment of gene and cell therapies using human hematopoietic cell transplants for the treatment of X-linked chronic granulomatous disease (X-CGD). This disease is characterized by defects in the production of microbicidal reactive oxygen species (ROS) by phagocytes. These mice may also be useful for modeling other phagocyte disorders in humanized NSG mouse xenografts.

Of note, The Jackson Laboratory will distribute mice heterozygous for the Cybb knock-out allele.

Detailed description

NSG.Cybb[KO] mice, also called X-CGD NSG, are NOD.scid.Il2Rγc^null ("NSG"; Stock No. 005557) animals also harboring the Cybb^em1Hmal knock-out allele (Cybb[KO]; a 235 bp deletion encompassing all of exon 1 and 190 bp of the upstream Cybb promoter).

Females homozygous for all three mutations, and males that are homozygous for scid and hemizygous for the X-linked mutations Cybb[KO] and Il2Rγc^null, may be collectively referred to as homozygous NSG.Cybb[KO] mice.

Although viable and fertile, homozygous NSG.Cybb[KO] mice are immunodeficient: they have no mature T cells or B cells, lack functional natural killer (NK) cells, have reduced numbers of lymphocytes and myeloid dendritic cells, and are deficient in cytokine signaling. They are permissive for xenograft/human tumor growth, with CYBB-deficiency resulting in defective phagocyte function. Specifically, homozygous NSG.Cybb[KO] are defective for production of reactive oxygen species (ROS) by neutrophils and other phagocytes (defective myeloid oxidative killing function), and demonstrate increased susceptibility to spontaneous bacterial and fungal infections with granulomatous inflammation (see maintenance note below).

The publication characterizing homozygous NSG.Cybb[KO] mice (Sweeney et al. 2017 Hum Gene Ther [PMID:28264583]) states that, like NSG mice, the NSG.Cybb[KO] mice could be engrafted with human hematopoietic stem/progenitor cells (HSPCs) to give rise to human CD45+ hematopoietic cells of multiple lineages, including CD13+ myeloid cells, CD14+ monocytes/macrophages, CD19+ B cells, CD56+ NK cells and CD3+ T cells. The donating investigator also reports that, not unexpectedly, busulfan treatment followed by transplantation of human X-CGD patient cells results in a high incidence of infection-associated morbidity (>50%) within 3-6 weeks, although not when the mice are transplanted instead with normal healthy human donor cells.

NSG.Cybb[KO] mice are a phagocyte-defective X-CGD NSG mouse model that allows in vivo assessment of gene and cell therapies using human hematopoietic cell transplants for the treatment of X-linked chronic granulomatous disease (X-CGD). This disease is characterized by defects in the production of microbicidal ROS by phagocytes. These mice may also be useful for modeling other phagocyte disorders in humanized NSG mouse xenografts.

Maintenance Note: Similar to other immunodeficient strains, maintaining homozygous NSG.Cybb[KO] mice in high health status (specific pathogen-free) vivaria promotes overall colony health. If homozygous NSG.Cybb[KO] animals are maintained in low health barrier rooms, the use of medicated water (e.g., sulfatrim/trimethoprim-sulfa or enrofloxacin/Baytril) is suggested to increase overall colony health.
The donating investigator reports that maintaining their NSG.Cybb[KO] colony in their specific pathogen-free mouse vivaria with sulfatrim antibiotic was not sufficient to prevent increased morbidity (due to spontaneous bacterial and fungal infections), and their NSG.Cybb[KO] mice had significantly decreased survival compared to NSG.Cybb[HET] and wildtype NSG mice. To decrease morbidity, they suggest handling the homozygous NSG.Cybb[KO] mice before other mouse lines in the same room, as well as routine changing of homozygous NSG.Cybb[KO] mouse cages prior to doing so for other mouse lines in the same room. They also recommend use of microisolator cages or other barrier facilities.

View our Resources for the NSG mouse model, including discussion forum, immunodeficient model comparison, and categorized, up-to-date references.

Development

NSG.Cybb[KO] mice, also called X-CGD NSG, are NOD.scid.Il2Rγc^null ("NSG") animals with the Cybb^em1Hmal knock-out allele (Cybb[KO]). NSG.Cybb[KO] mice harbor several mutations, as described below.

NSG mice are non-obese diabetic animals (NOD/ShiLtJ) harboring the spontaneous severe combined immunodeficiency mutation (Prkdc^scid) on chromosome 16 and the Il2Rγc^null mutation at ~101 Mbp on the X chromosome (Il2rg^tm1Wjl created by Dr. Warren J. Leonard [NIH]). NSG mice are described and available from The Jackson Laboratory Repository as Stock No. 005557.

The Cybb^em1Hmal knock-out allele (Cybb[KO]) was created in the laboratory of Dr. Harry L. Malech (National Institutes of Health (LHD/NIAID/NIH)) using CRISPR/Cas9 genome engineering in NSG mouse zygotes (from Stock No. 005557). The cytochrome b-245 beta polypeptide locus (Cybb; gp91^phox) on the X chromosome (~9.4 Mbp) was targeted with a specific single guide RNA (GGTACTTACAATGACAAAGA) targeted to exon 1. Female founder mouse 1-3 was identified with a 235 bp deletion encompassing all of exon 1 and 190 bp of the upstream Cybb promoter. This founder was bred to NSG mice, and the offspring were bred together to establish the NSG.Cybb[KO] colony. Thereafter, they maintained their colony by breeding females homozygous for scid, heterozygous for Cybb[KO] and homozygous for Il2Rγc^null with NSG males homozygous for scid, wildtype at the X-linked Cybb locus and hemizygous for the X-linked Il2Rγc^null (obtained from Stock No. 005557 every generation).

In 2017, Dr. Malech sent NSG.Cybb[KO] triple mutant mice (albino) to The Jackson Laboratory Repository as Stock No. 030610.

Allele

Symbol: Prkdc^scid
Name: severe combined immunodeficiency
MGI accession ID: MGI:1857113
Generation method: Spontaneous
Synonyms: scid
Marker symbol: Prkdc
Marker name: protein kinase, DNA activated, catalytic polypeptide
Marker synonyms: DNAPDcs; DNAPK; DNA-PK; DNAPKc; DNA-PKC; DNA-PKcs; DNPK1; DOXNPH; dxnph; HYRC; HYRC1; IMD26; p350; S473K; slip; XRCC7
Chromosome: 16
Strain of origin: C.BKa-Igh^b/Icr
Site of expression: T and B lymphocytes.
Molecular note: A T-to-A transversion point mutation at a position corresponding to codon 4046 (codon 4095 in transcript ENSMUST00000023352.8) created a premature stop codon (p.Y4046*).

Allele

Symbol: Il2rg^tm1Wjl
Name: targeted mutation 1, Warren J Leonard
MGI accession ID: MGI:1857455
Generation method: Targeted
Attributes: Null/Knockout
Synonyms: [KO]gammac; CD132^-; gammac^-; gc^-; Il2rg^tm1Wjll; IL2Rgamma^null
Marker symbol: Il2rg
Marker name: interleukin 2 receptor, gamma chain
Marker synonyms: [g]c; Ab2-183; Cd132; CIDX; common cytokine receptor gamma chain; common gamma chain; gamma C receptor; gamma(c); gammaC; gc; IL-2RG; IMD4; P64; SCIDX; SCIDX1
Chromosome: X
Strain of origin: 129S4/SvJae
Site of expression: Primarily lymphoid cells.
Molecular note: A neomycin resistance cassette replaced part of exon 3 and all of exons 4 - 8 of the gene, resulting in the loss of most of the extracellular domain and all of the transmembrane and cytoplasmic domains of the protein.

Allele

Symbol: Cybb^em1Hmal
Name: endonuclease-mediated mutation 1, Harry Malech
MGI accession ID: MGI:5902368
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Marker symbol: Cybb
Marker name: cytochrome b-245, beta polypeptide
Marker synonyms: AMCBX2; Cgd; CGDX; gp91^phox; GP91-1; GP91PHOX; Gp91-phox; IMD34; NOX2; p91-PHOX
Chromosome: X
Strain of origin: NOD.Cg-Prkdc^scid Il2rg^tm1Wjl/SzJ
Molecular note: Using CRISPR/Cas9 genome engineering, Cybb is targeted with a specific single guide RNA (GGTACTTACAATGACAAAGA) targeted to exon 1. The mutation is identified as a 235 bp deletion encompassing all of exon 1 and 190 bp of the upstream Cybb promoter.