B6N;FVB-Cltc^em1(IMPC)J/Mmjax

Stock number: 030244

Description

This CRISPR-generated knock-out mutant of the clathrin, heavy polypeptide (Hc) (Cltc) gene has been generated by the Knockout Mouse Phenotyping Program (KOMP²) at The Jackson Laboratory. Cltc encodes a protein component of the cytoplasmic face of intracellular organelles and plays a role in early autophagosome formation.

Detailed description

This strain was generated by the Knockout Mouse Phenotyping Program (KOMP²) at The Jackson Laboratory using CRISPR technology. The targeted gene, clathrin, heavy polypeptide (Hc) (Cltc), encodes a protein component of the cytoplasmic face of intracellular organelles and plays a role in early autophagosome formation. The alteration resulted in the deletion of 632 bp, which should result in the deletion of exon 2, amino acid change after residue 15, and early termination 10 amino acids later.

Development

Guide RNAs (CTAAAAGCATTTCTGTATAG, TTTATATCTGACATGATAAA, AGTGTAACTTACAACTACAG and TTGTCACTATTGGTTTGGCA), designed to delete 632 bp in exon 2 of the clathrin, heavy polypeptide (Hc) (Cltc) gene, and Cas9 nuclease were introduced into C57BL/6NJ-derived fertilized eggs with well recognized pronuclei. Embryos were transferred to pseudopregnant females. Correctly targeted pups were identified by PCR and further bred to C57BL/6NJ (Stock No. 005304) to develop the colony. Due to low productivity from the C57BL/6NJ coisogenic colony, mice were crossed to FVB/NJ inbred mice (Stock No. 001800) for at least one generation to improve viability of offspring.

Allele

Symbol: Cltc^em1(IMPC)J
Name: endonuclease-mediated mutation 1, Jackson
MGI accession ID: MGI:5823473
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Synonyms: Cltc^em1J
Marker symbol: Cltc
Marker name: clathrin, heavy polypeptide (Hc)
Marker synonyms: CHC; CHC17; CLH-17; CLTCL2; Hc; MRD56
Chromosome: 11
Strain of origin: C57BL/6NJ
Molecular note: This allele from project Cltc-8204J-M4288 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTAAAAGCATTTCTGTATAG, TTTATATCTGACATGATAAA, AGTGTAACTTACAACTACAG and TTGTCACTATTGGTTTGGCA, which resulted in a 632 bp deletion beginning at Chromosome 11 negative strand position 86,737,459 bp TGTAGTTGTAAGTTACACTA and ending after CATTTTATATCTGACATGAT at 86,736,824 bp (GRCm38/mm10). This mutation deletes exon 2 and 424 bp of flanking intronic sequence including the splice acceptor and donor, however it retains 4 bp of the exon (AGAG), which will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 15 and early truncation 10 amino acids later.