B6.Cg-Plcg2^em1Msasn/J

Stock number: 029598
Product name: Plcg2^R522
Research areas: Neurobiology Research

Description

The CRISPR/Cas9 generated Plcg2^R522 mutant of the Plcg2 gene carries a single nucleotide change at c.1565 C>G (p. P522R), which models a human SNP. These mice may be suitable for use in studies related to Alzheimer's disease.

Detailed description

CRISPR/cas9 endonuclease mediated genome editing of the Plcg2, phospholipase C, gamma 2, gene was used to introduce a single nucleotide change at c.1565 C>G (p. P522R). The targeted Plcg2 gene encodes a transmembrane enzyme that acts as a signaling molecule in such diverse biological processes as hematopoietic cells differentiation, tissue morphogenesis, autoinflammation, antibody deficiency, and autoimmunity. Mutations in this gene have been associated with PLCG2-associated antibody deficiency and immune dysregulation (PLAID). This point mutation models a human SNP that was identified in a whole exome chip of rare SNPs associated with Alzheimer's disease. As the mice are characterized, we will modify the strain description and add phenotype data. Homozygotes are viable. Homozygous fertility has not been tested (July 2019). Primary culture microglia from the cortex and hippocampus of mutant neonates exhibit increased intracellular Ca²⁺ store release when stimulated indicating that R522 is a hyperfunctional (protective) variant mutant.

Development

Plasmids encoding a signal guide RNA designed to introduce a single nucleotide change at c.1565 C>G (p. P522R) in the Plcg2 gene and the cas9 nuclease were introduced into the cytoplasm of B6(SJL)-Apoe^{tm1.1(APOE*4)Adiuj}/J (Stock#027894) derived fertilized eggs with well recognized pronuclei. Correctly targeted embryos were transferred to pseudopregnant females. Correctly targeted pups were identified by sequencing and PCR and further bred to C57BL/6J (Stock No. 000664) for 2 generations to breed out the Apoe^{tm1.1(APOE*4)Adiuj} allele and develop the colony.  Sperm was then cryopreserved.

Allele

Symbol: Plcg2^em1Msasn
Name: endonuclease-mediated mutation 1, Michael Sasner
MGI accession ID: MGI:6316314
Generation method: Endonuclease-mediated
Attributes: Humanized sequence
Synonyms: Plcg2^P522R; Plcg2^R522
Marker symbol: Plcg2
Marker name: phospholipase C, gamma 2
Marker synonyms: APLAID; FCAS3; MGC:38590; Plcg-2; PLCgamma2; PLC-gamma-2; PLC-IV
Chromosome: 8
Strain of origin: B6(SJL)-Apoe^{tm1.1(APOE*4)Adiuj}/J
Molecular note: A C-to-G mutation was engineered in proline codon 522 (CCC) to change it to an arginine codon (CGC) (c.1565C>G, p.P522R) with an sgRNA (targeting CCAAAATGCAGCTCCGTGGG) and an ssODN template (GAGCTGTAATAAGCCCTTTCGGATGCTTGTGGCTCAGGACACTCGCCCCACGGAGCTGCATTTTGGGGAGAAATGGTTCCACA) using CRISPR/Cas9 technology. The mutation models a human SNP that was identified in a whole exome chip of rare SNPs associated with Alzheimer's disease and has been associated with protection from Alzheimer's disease.