C57BL/6J-Kcnq2^em5Lutzy/Mmjax

Stock number: 029408
Product name: Kcnq2^E254fs*16
Research areas: Cell Biology Research, Mouse/Human Gene Homologs, Neurobiology Research

Description

Kcnq2^E254fs*16 knock-in mice carry a CRISPR/Cas9-generated 7nt deletion in the Kcnq2 (potassium voltage-gated channel, subfamily Q, member 2) gene. This strain may be useful for studying KCNQ2 encephalopathy.

Note that the donating investigator has made a Kcnq2^G256W mouse line available as RRID:MMRRC-071896-JAX.

Detailed description

Kcnq2^E254fs*16 knock-in (KI) mice harbor a CRISPR/Cas9-generated 7nt deletion in the potassium voltage-gated channel, subfamily Q, member 2 (Kcnq2) gene. Kcnq2 gene encodes a neuronal voltage-gated potassium M channel subunit. The M channel, formed by the association of KCNQ2 and KCNQ3, is a slow activating/deactivating potassium channel that regulates neuron excitability. Mutations in the human KCNQ2 gene cause benign familial neonatal seizures-1 and Early Infantile Epileptic Encephalopathy 7.

Heterozygous Kcnq2^E254fs*16 KI mice are viable and fertile; however, homozygous mice are perinatal lethal. The donating laboratory notes a ~30% reduction in total Kcnq2 mRNA extracted from heterozygous brain tissues compared to wildtype controls. No significant difference noted in Kcnq2^E254fs*16 mortality compared to wildtype controls, up to ~300 days of age. These Kcnq2^E254fs*16 KI mice may be useful for studying KCNQ2 encephalopathy.

Note that the donating investigator has made a Kcnq2^G256W mouse line available as RRID:MMRRC-071896-JAX.

Development

The Kcnq2^E254fs*16 knock-in (KI) allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. Guide RNAs (CTGGTGTACTTGGCAGAAAA and TCTGGTGTACTTGGCAGAAA) were used to target the potassium voltage-gated channel, subfamily Q, member 2 (Kcnq2) gene on chromosome 2. Donor DNAs were originally designed to introduce a G256W mutation, as described for MMRRC: 071896. Guide RNAs, cas9, and the oligo donor were introduced to single cell C57BL/6J zygotes and transferred to pseudo pregnant females. DNA sequencing of the targeted region identified a single founder female that carried the desired G256W mutation in trans to a frameshifting indel E254fs*16 mutation (deletion of the AAAAGGG nucleotides overlapping with the PAM sequence). The two alleles were separated and two distinct lines [Kcnq2^G256W (MMRRC: 071896) and Kcnq2^E254fs*16 (MMRRC: 071897)] were established by backcrossing to C57BL/6J for at least 3 generations.

Allele

Symbol: Kcnq2^em5Lutzy
Name: endonuclease-mediated mutation 5, Cathy Lutz
MGI accession ID: MGI:7714664
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Synonyms: KCNQ2 E254fs
Marker symbol: Kcnq2
Marker name: potassium voltage-gated channel, subfamily Q, member 2
Marker synonyms: BFNC; DEE7; EBN; EBN1; ENB1; HNSPC; KCNA11; KQT2; KV7.2; Nmf134
Chromosome: 2
Strain of origin: C57BL/6J
Molecular note: The allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. Guide RNAs (CTGGTGTACTTGGCAGAAAA and TCTGGTGTACTTGGCAGAAA) were used to target the potassium voltage-gated channel, subfamily Q, member 2 (Kcnq2) gene resulting in a frameshifting indel E254fs*16 mutation (deletion of the AAAGGG nucleotides. Donor DNAs were originally designed to introduce a G256W mutation Kcnq2^em4Lutzy. DNA sequencing of the targeted region identified a single founder female that carried the desired G256W mutation in trans to a frameshifting indel E254fs*16 mutation (deletion of the AAAGGGG 7 nucleotides overlapping with the PAM sequence).